Haplogroup Q (Y-DNA) - AbsoluteAstronomy.com

Human genetics

Human genetics describes the study of inheritance as it occurs in human beings. Human genetics encompasses a variety of overlapping fields including: classical genetics, cytogenetics, molecular genetics, biochemical genetics, genomics, population genetics, developmental genetics, clinical genetics,...

, Haplogroup Q (M242) is a Y-chromosome DNA haplogroup.

Origins

Haplogroup

In the study of molecular evolution, a haplogroup is a group of similar haplotypes that share a common ancestor having the same single nucleotide polymorphism mutation in both haplotypes. Because a haplogroup consists of similar haplotypes, this is what makes it possible to predict a haplogroup...

Q is one of the two branches of haplogroup P

Haplogroup P (Y-DNA)

In human genetics, Haplogroup P is a Y-chromosome DNA haplogroup.This haplogroup contains the patrilineal ancestors of most Europeans and almost all of the indigenous peoples of the Americas...

(M45). Haplogroup Q is believed to have arisen in Central Asia

Central Asia

Central Asia is a core region of the Asian continent from the Caspian Sea in the west, China in the east, Afghanistan in the south, and Russia in the north...

approximately 15,000 to 20,000 years ago. It has had multiple origins proposed. Much of the conflict may be attributed to limited sample sizes and early definitions that used a combination of M242, P36.2, and MEH2 as defining mutations.

This haplogroup has many diverse haplotype

Haplotype

A haplotype in genetics is a combination of alleles at adjacent locations on the chromosome that are transmitted together...

s despite its low frequency among most populations outside of the Americas. There also are over a dozen subclade

Subclade

In genetics, subclade is a term used to describe a subgroup of a subgenus or haplogroup. It is commonly used today in describing genealogical DNA tests of human mitochondrial DNA haplogroups and human Y-chromosome DNA haplogroups....

s that have been sampled and identified in modern populations.

Technical specification of mutation

The technical details of M242 are:

Nucleotide change: C to T

Position (base pair): 180

Total size (base pairs): 366

Forward 5′→ 3′: aactcttgataaaccgtgctg

Reverse 5′→ 3′: tccaatctcaattcatgcctc

Subclades

In Y-chromosome phylogenetics, subclades are the branches of haplogroups. These subclades are also defined by single nucleotide polymorphisms (SNPs) or unique event polymorphisms (UEPs). Haplogroup Q, according to the most recent available phylogenetics has between 15 and 21 subclades. The scientific understanding of these subclades has changed rapidly. Many key SNPs and corresponding subclades were unknown to researchers at the time of publication are excluded from even recent research. This makes understanding the meaning of individual migration paths challenging.

Haplogroup and Subclade Defining SNPs

Academic Name	RS ID	Position	Change	YCC 2008 rev	ISOGG 2008	Parent Clade
P48
13006660-13006661	–>T	Q1a4	Q1a4	MEH2		This is now considered a private SNP. The positive sample from Karafet 2008 was retested at the Family Tree DNA GRC and was found to be negative.
L57	rs34864948	14083496	A/G
P36.2
L191
2947379	A>del
{M346, L56, L57}		The L191 SNP was found while testing a sample for M346 at the Family Tree DNA GRC. This SNP may represent a native Mexican lineage. L191 may represent single family or limited population group. Additional testing and a published haplotype or haplotypes are needed.
L213	rs34549365	8295033	C>G
{M346, L56, L57}
L245
5735090	C>G
{M378, L214, L215}
M346
2947156	C>G	Q1a3	Q1a3	MEH2
L215	rs34601266	13399368	C>T
P36.2
L55	rs35768544	17922729	G>A
{M346, L56, L57}
L53	rs34724285	20101684	G>A
{M346, L56, L57}
L54	rs34954951	21702170	G>A
{M346, L56, L57}
L232
16025489	G>A
M242		The SNP was found during WTY testing at the Family Tree DNA GRC.
L56	rs34703625	8208869	G>A
P36.2
P36.2
13006449	G>T	Q1	Q1	M242
MEH2	rs4252209	4985637	G>T	Q1a	Q1a	P36.2
L214	rs34694026	20365995	T>C
P36.2
M3	rs3894	17605757	C>T	Q1a3a	Q1a3a	{L53, L54, L55}
M194	rs2032677	13523944	T>C	Q1a3a2	Q1a3a2	M3
P292	rs13447374	13540161	–>G	Q1a3a3	Q1a3a3	M3
P106
13932316	G>A	Q1a3a3	Q1a3a3	M3
M19	rs3910	20192619	T>A	Q1a3a1	Q1a3a1	M3
M199	rs2032589	13540505-13540504	–>G	Q1a3a3	Q1a3a3	M3
M323	rs13447377	20327106	C>T	Q1a6	Q1a6	M346
P89.1
13359859	G>T	Q1a5	Q1a5	MEH2		Limited research indicates that this may be a private SNP. The P89 mutation is also found in R1b.
M265, N14	rs3212294	13540044	C>A	Q1a1	Q1a1	MEH2
M242	rs8179021	13527976	C>T	Q	Q	P SNPs
M378
13536901	A>G	Q1b	Q1b	P36.2
M25
20326052	G>C	Q1a2	Q1a2	P36.2
M143
20349206	G>T	Q1a2	Q1a2	P36.2
M120
20366782	T>C	Q1a1	Q1a1	P36.2

Phylogenetic naming variations

The subclade proposed by Sharma 2007 (SS4bp, rs41352448) is not represented in any current trees because it is a value for the STR

Short tandem repeat

A short tandem repeat in DNA occurs when a pattern of two or more nucleotides are repeated and the repeated sequences are directly adjacent to each other. The pattern can range in length from 2 to 5 base pairs and is typically in the non-coding intron region...

DYS435 with a value of 12. This low frequency value has been found as a novel Q lineage (Q5) in Indian populations.

Phylogenetic Trees

There are several confirmed and proposed phylogenetic trees available for haplogroup Q. The scientifically accepted one is the Y-Chromosome Consortium (YCC) one published in Karafet 2008 and subsequently updated. A draft tree that shows emerging science is provided by Thomas Krahn at the Genomic Research Center in Houston, Texas

Houston, Texas

Houston is the fourth-largest city in the United States, and the largest city in the state of Texas. According to the 2010 U.S. Census, the city had a population of 2.1 million people within an area of . Houston is the seat of Harris County and the economic center of , which is the ...

. The International Society of Genetic Genealogy (ISOGG) also provides an amateur tree.

The Genomic Research Center Draft Tree

This is Thomas Krahn at the Genomic Research Center's Draft tree Proposed Tree for haplogroup Q.

P
Haplogroup P (Y-DNA)
In human genetics, Haplogroup P is a Y-chromosome DNA haplogroup.This haplogroup contains the patrilineal ancestors of most Europeans and almost all of the indigenous peoples of the Americas...
- Q M242
  - P36.2, L232, L273, L274
    - MEH2
      - M120, N14, M265
      - M25, M143
      - M346, L56, L57
        
        L53, L54, L55, L213, L331
        
        M3, PAGES00104, PAGES00126, PAGES00131
        
        M19
        
        M194
        
        M199, P106, P292
        
        L191
        
        L330, L334
        
        L329, L332, L333
        
        L400, L401
        
        L456
        
        M323
      - P89.1
    - L275, L314
      - M378, L214, L215
        
        L245
        
        L272.1
        
        L315
        
        L301
        
        L327

The Y-Chromosome Consortium 2008 tree

This is the official scientific tree produced by the Y-Chromosome Consortium (YCC). The last major update was in 2008. Subsequent updates have been quarterly and biannual.

P
Haplogroup P (Y-DNA)
In human genetics, Haplogroup P is a Y-chromosome DNA haplogroup.This haplogroup contains the patrilineal ancestors of most Europeans and almost all of the indigenous peoples of the Americas...
- Q M242
  - Q1 P36.2
    - Q1a MEH2
      - Q1a1 M120, N14, M265
      - Q1a2 M25, M143
      - Q1a3 M346
        
        Q1a3a M3
        
        Q1a3a1 M19
        
        Q1a3a2 M194
        
        Q1a3a3 M199, P106, P292
        
        Q1a3b M323
      - Q1a4 P48
      - Q1a5 P89.1
    - Q1b M378

The 2011 ISOGG Tree

The subclade

Subclade

s of Haplogroup Q with their defining mutation(s), according to the 2011 ISOGG tree are provided below.

Q M242
- Q1 P36.2, L232, L273, L274
  - Q1a MEH2
    - Q1a1 M120, M265/N14
    - Q1a2 M25, M143
    - Q1a3
      Haplogroup Q1a3 (Y-DNA)
      Haplogroup Q1a3 is a subclade of Y-DNA Haplogroup Q. Haplogroup Q1a3 is defined by the presence of the M346 Single Nucleotide Polymorphism and may therefore be referred to as Q-M346 in shorthand.- Distribution :...
      
      L56, L57, M346, L528
      - Q1a3a L53, L54, L55, L213, L331
        
        Q1a3a1 M3
        
        Q1a3a1a M19
        
        Q1a3a1b M194
        
        Q1a3a1c M199, P106, P292
        
        Q1a3a2 L191
        
        Q1a3a3 L330, L334
        
        Q1a3a3a L329, L332, L333
      - Q1a3b M323
      - Q1a3c L527, L529
  - Q1b L275, L314
    - Q1b1 M378/Page100, L214, L215/Page82
      - Q1b1a L245
        
        Q1b1a1 L272.1

Distribution

Haplogroup Q may be one of the most widely distributed Y-chromosome lineages in the modern world. It is found in the Americas

Americas

The Americas, or America , are lands in the Western hemisphere, also known as the New World. In English, the plural form the Americas is often used to refer to the landmasses of North America and South America with their associated islands and regions, while the singular form America is primarily...

, North Africa

North Africa

North Africa or Northern Africa is the northernmost region of the African continent, linked by the Sahara to Sub-Saharan Africa. Geopolitically, the United Nations definition of Northern Africa includes eight countries or territories; Algeria, Egypt, Libya, Morocco, South Sudan, Sudan, Tunisia, and...

, East Asia

East Asia

East Asia or Eastern Asia is a subregion of Asia that can be defined in either geographical or cultural terms...

, South Asia

South Asia

South Asia, also known as Southern Asia, is the southern region of the Asian continent, which comprises the sub-Himalayan countries and, for some authorities , also includes the adjoining countries to the west and the east...

, West Asia, and in Europe

Europe

Europe is, by convention, one of the world's seven continents. Comprising the westernmost peninsula of Eurasia, Europe is generally 'divided' from Asia to its east by the watershed divides of the Ural and Caucasus Mountains, the Ural River, the Caspian and Black Seas, and the waterways connecting...

The Americas

Haplogroup Q is the predominant Y-chromosome haplogroup in indigenous peoples of the Americas

Indigenous peoples of the Americas

The indigenous peoples of the Americas are the pre-Columbian inhabitants of North and South America, their descendants and other ethnic groups who are identified with those peoples. Indigenous peoples are known in Canada as Aboriginal peoples, and in the United States as Native Americans...

.

Approximately 20,000 to 15,000 years ago, a group migrated from Asia into the Americas

Models of migration to the New World

There have been several models for the human settlement of the Americas proposed by various academic communities. The question of how, when and why humans first entered the Americas is of intense interest to archaeologists and anthropologists, and has been a subject of heated debate for centuries...

by crossing the Bering Strait

Bering Strait

The Bering Strait , known to natives as Imakpik, is a sea strait between Cape Dezhnev, Chukotka Autonomous Okrug, Russia, the easternmost point of the Asian continent and Cape Prince of Wales, Alaska, USA, the westernmost point of the North American continent, with latitude of about 65°40'N,...

. Many of the men in this group must have belonged to haplogroup Q for it now accounts for the majority of non-European haplogroups in indigenous peoples of the Americas

Indigenous peoples of the Americas

.

Indeed, haplogroup Q has been found in approximately 94% of Indigenous

Indigenous peoples of the Americas

peoples of South America

South America

South America is a continent situated in the Western Hemisphere, mostly in the Southern Hemisphere, with a relatively small portion in the Northern Hemisphere. The continent is also considered a subcontinent of the Americas. It is bordered on the west by the Pacific Ocean and on the north and east...

and detected in Na-Dené speakers

Na-Dené languages

Na-Dene is a Native American language family which includes at least the Athabaskan languages, Eyak, and Tlingit languages. An inclusion of Haida is controversial....

at a rate of 25-50%, and North American Eskimo–Aleut populations at about 46%.

In more modern population groups from the Americas, all Q samples tested for M346 have been positive. This founding population spread throughout the Americas. In the Americas, a member of the founding population underwent a mutation, producing its descendant population defined by the M3 single nucleotide polymorphism

Single nucleotide polymorphism

A single-nucleotide polymorphism is a DNA sequence variation occurring when a single nucleotide — A, T, C or G — in the genome differs between members of a biological species or paired chromosomes in an individual...

(SNP). Many members of haplogroup Q in the Americas

Americas

belong to the Q-M3 subclade.

However, a 4000-year-old Saqqaq

Saqqaq culture

The Saqqaq culture was a Paleo-Eskimo culture in Greenland.-Timeframe:...

individual belonging to Q-MEH2 haplogroup has been documented.

Asia

Likely due to its origin in Central Asia

Central Asia

Central Asia is a core region of the Asian continent from the Caspian Sea in the west, China in the east, Afghanistan in the south, and Russia in the north...

, haplogroup Q may be found throughout Asia

Asia

Asia is the world's largest and most populous continent, located primarily in the eastern and northern hemispheres. It covers 8.7% of the Earth's total surface area and with approximately 3.879 billion people, it hosts 60% of the world's current human population...

. It has been reported that Q is found in the Altai people, India

India

India , officially the Republic of India , is a country in South Asia. It is the seventh-largest country by geographical area, the second-most populous country with over 1.2 billion people, and the most populous democracy in the world...

, Tibet

Tibet

Tibet is a plateau region in Asia, north-east of the Himalayas. It is the traditional homeland of the Tibetan people as well as some other ethnic groups such as Monpas, Qiang, and Lhobas, and is now also inhabited by considerable numbers of Han and Hui people...

, Pakistan

Pakistan

Pakistan , officially the Islamic Republic of Pakistan is a sovereign state in South Asia. It has a coastline along the Arabian Sea and the Gulf of Oman in the south and is bordered by Afghanistan and Iran in the west, India in the east and China in the far northeast. In the north, Tajikistan...

, China

China

Chinese civilization may refer to:* China for more general discussion of the country.* Chinese culture* Greater China, the transnational community of ethnic Chinese.* History of China* Sinosphere, the area historically affected by Chinese culture...

, Mongolia

Mongolia

Mongolia is a landlocked country in East and Central Asia. It is bordered by Russia to the north and China to the south, east and west. Although Mongolia does not share a border with Kazakhstan, its western-most point is only from Kazakhstan's eastern tip. Ulan Bator, the capital and largest...

, Tuvans

Tuvans

Tuvans or Tuvinians are Turkic peoples living in southern Siberia. They are historically known as one of the Uriankhai, from the Mongolian designation...

, and Uyghurs

Uyghur people

The Uyghur are a Turkic ethnic group living in Eastern and Central Asia. Today, Uyghurs live primarily in the Xinjiang Uyghur Autonomous Region in the People's Republic of China...

East Asia

To the east, haplogroup Q has been found in approximately 4% of Southern Altaians and 32% of Northern Altaians. It is found in 16% of Tuvans

Tuvans

Tuvans or Tuvinians are Turkic peoples living in southern Siberia. They are historically known as one of the Uriankhai, from the Mongolian designation...

.

The frequency of Q in northern China is about 4%, with many Chinese samples of haplogroup Q belonging to the subclade Q-M120. Haplogroup Q is found in approximately 3% of males in Tibet

Tibet

and Mongolia

Mongolia

.
It is also found in 3% of Uyghurs

Uyghur people

The Uyghur are a Turkic ethnic group living in Eastern and Central Asia. Today, Uyghurs live primarily in the Xinjiang Uyghur Autonomous Region in the People's Republic of China...

.

The highest frequencies of Q in Asia are found among the Selkups (~70%) and Kets (~95%), they live in western and middle Siberia

Siberia

Siberia is an extensive region constituting almost all of Northern Asia. Comprising the central and eastern portion of the Russian Federation, it was part of the Soviet Union from its beginning, as its predecessor states, the Tsardom of Russia and the Russian Empire, conquered it during the 16th...

and their populations are small in number, being just under 5,000 and 1,500, respectively.

South Asia

A Biomed study observed an ancestral state Q* and a novel sub-branch Q5, not reported elsewhere, in the Indian subcontinent

Indian subcontinent

The Indian subcontinent, also Indian Subcontinent, Indo-Pak Subcontinent or South Asian Subcontinent is a region of the Asian continent on the Indian tectonic plate from the Hindu Kush or Hindu Koh, Himalayas and including the Kuen Lun and Karakoram ranges, forming a land mass which extends...

, though in low frequency. A novel subgroup Q4 was identified recently which is also restricted to the Indian subcontinent. The most plausible explanation for these observations could be an ancestral migration of individuals bearing ancestral lineage Q* to the Indian subcontinent followed by an autochthonous differentiation

Indigenous peoples

Indigenous peoples are ethnic groups that are defined as indigenous according to one of the various definitions of the term, there is no universally accepted definition but most of which carry connotations of being the "original inhabitants" of a territory....

to Q4 and Q5 sublineages later on. Thus the subcontinent has three novel Q lineages, an ancestral Q* (different from the Central Asian Q*), Q4 and Q5 unique to the subcontinent.

West Asia

Two studies conducted Ivan Nasidze in 2004 and 2009, show that the frequency of Q in Iran, varies between approximately 2% to 6%, depending on region. Iranian samples of haplogroup Q belong primarily to the subclade Q-M25.

In Pakistan

Pakistan

, at the eastern end of the Iranian plateau, the frequency of haplogroup Q is about 2.2% (14/638) or 3.4% (6/176).

Approximately 2.5% of males in Saudi Arabia

Saudi Arabia

The Kingdom of Saudi Arabia , commonly known in British English as Saudi Arabia and in Arabic as as-Sa‘ūdiyyah , is the largest state in Western Asia by land area, constituting the bulk of the Arabian Peninsula, and the second-largest in the Arab World...

belong to haplogroup Q.

According to Behar et al. 5% of Ashkenazi males belong to haplogroup Q. This has subsequently been found to be entirely the Q-M378 subclade and may be restricted to Q-L245.

Haplogroup Q has also been found in Algeria

Algeria

Algeria , officially the People's Democratic Republic of Algeria , also formally referred to as the Democratic and Popular Republic of Algeria, is a country in the Maghreb region of Northwest Africa with Algiers as its capital.In terms of land area, it is the largest country in Africa and the Arab...

ns, Arabians, Syrians, Lebanese

Lebanese people

The Lebanese people are a nation and ethnic group of Levantine people originating in what is today the country of Lebanon, including those who had inhabited Mount Lebanon prior to the creation of the modern Lebanese state....

and the United Arab Emirates

United Arab Emirates

The United Arab Emirates, abbreviated as the UAE, or shortened to "the Emirates", is a state situated in the southeast of the Arabian Peninsula in Western Asia on the Persian Gulf, bordering Oman, and Saudi Arabia, and sharing sea borders with Iraq, Kuwait, Bahrain, Qatar, and Iran.The UAE is a...

Europe

The frequency of haplogroup Q in Norway

Norway

Norway , officially the Kingdom of Norway, is a Nordic unitary constitutional monarchy whose territory comprises the western portion of the Scandinavian Peninsula, Jan Mayen, and the Arctic archipelago of Svalbard and Bouvet Island. Norway has a total area of and a population of about 4.9 million...

and Sweden

Sweden

Sweden , officially the Kingdom of Sweden , is a Nordic country on the Scandinavian Peninsula in Northern Europe. Sweden borders with Norway and Finland and is connected to Denmark by a bridge-tunnel across the Öresund....

is about 3%, while 2,5% of Slovak males are in haplogroup Q.

To the south east, approximately 2% of males in Turkey

Turkey

Turkey , known officially as the Republic of Turkey , is a Eurasian country located in Western Asia and in East Thrace in Southeastern Europe...

, In a study by Gokcumen it was found that among Turks

Turkish people

Turkish people, also known as the "Turks" , are an ethnic group primarily living in Turkey and in the former lands of the Ottoman Empire where Turkish minorities had been established in Bulgaria, Cyprus, Bosnia and Herzegovina, Georgia, Greece, Kosovo, Macedonia, and Romania...

that belong to the Afshar tribe

Afshar tribe

Afshars, also called Avshar are a branch of the Turkic Oghuz groups. These originally nomadic Oghuz tribes moved from Central Asia through Iran, Afghanistan, Syria, and finally most of them settled in Anatolia.Most of Afshars are followers of Shia Islam....

haplogroup Q is seen with a prevalence of 13%. Further, the Q-M25 subclade has been found in Turkey

Turkey

Turkey , known officially as the Republic of Turkey , is a Eurasian country located in Western Asia and in East Thrace in Southeastern Europe...

Q-M346 is found among the Khanty

Khanty people

Khanty / Hanti are an indigenous people calling themselves Khanti, Khande, Kantek , living in Khanty-Mansi Autonomous Okrug, a region historically known as "Yugra" in Russia, together with the Mansi. In the autonomous okrug, the Khanty and Mansi languages are given co-official status with Russian...

Population Frequencies from Studies

Population		Paper	N	Percentage	SNPs Tested
Austro-Asiatic (Khasi-Khmuic)		Reddy 2009	353	5.40	P-M45(xM173) §
Austro-Asiatic (Mundari)		Reddy 2009	64	10.90	P-M45(xM173) §
Nicobarese (Mon-Khmer)		Reddy 2009	11	0.00	P-M45(xM173) §
Austro-Asiatic (Southeast Asia)		Reddy 2009	257	1.60	P-M45(xM173) §
Garo (Tibeto-Burman)		Reddy 2009	71	1.40	P-M45(xM173) §
Tibeto-Burman (India)		Reddy 2009	226	3.10	P-M45(xM173) §
Tibeto-Burman (East Asia)		Reddy 2009	214	0.00	P-M45(xM173) §
Indo-European (Eastern India)		Reddy 2009	54	18.50	P-M45(xM173) §
Southern Talysh	Iran	Nasidze 2009	50	4.00	P-M45(xM124,xM173)
Northern Talysh	Azerbaijan	Nasidze 2009	40	5.00	P-M45(xM124,xM173)
Mazandarana	Iran	Nasidze 2009	50	4.00	P-M45(xM124,xM173)
Gilakia	Iran	Nasidze 2009	50	0.00	P-M45(xM124,xM173)
Iranians (Tehran)	Iran	Nasidze 2004	80	4.00	P-M45(xM124,xM173)
Iranians (Isfahan)	Iran	Nasidze 2004	50	6.00	P-M45(xM124,xM173)
Bakhtiari	Iran	Nasidze 2008	53	2.00	P-M45(xM124,xM173)
Iranian Arabs	Iran	Nasidze 2008	47	2.00	P-M45(xM124,xM173)
North Iran	Iran	Regueiro 2006	33	9.00	P-M45(xM124,xM173)
South Iran	Iran	Regueiro 2006	117	3.00	P-M45(xM124,xM173)
Georgians	South Caucacus	Nasidze and Stoneking 2001	77	3.00	P-M45(xM124,xM173)
Armenians	South Caucacus	Nasidze and Stoneking 2001	100	2.00	P-M45(xM124,xM173)
Azerbaijanis	South Caucacus	Nasidze and Stoneking 2001	72	0.00	P-M45(xM124,xM173)

§ These may include members of haplogroup R2
Haplogroup R2 (Y-DNA)
- Paragroup R2a* :Paragroup is a term used in population genetics to describe lineages within a haplogroup that are not defined by any additional unique markers...

.

Subclade Distribution

Q (M242)
- Q* — Found with low frequency in India
  India
  India , officially the Republic of India , is a country in South Asia. It is the seventh-largest country by geographical area, the second-most populous country with over 1.2 billion people, and the most populous democracy in the world...
  
  and Pakistan
  Pakistan
  Pakistan , officially the Islamic Republic of Pakistan is a sovereign state in South Asia. It has a coastline along the Arabian Sea and the Gulf of Oman in the south and is bordered by Afghanistan and Iran in the west, India in the east and China in the far northeast. In the north, Tajikistan...
  
  .
- Q1 (P36.2)
  - Q1a (MEH2)
    - Q1a* Was found in Koryaks
      Koryaks
      Koryaks are an indigenous people of Kamchatka Krai in the Russian Far East, who inhabit the coastlands of the Bering Sea to the south of the Anadyr basin and the country to the immediate north of the Kamchatka Peninsula, the southernmost limit of their range being Tigilsk. They are akin to the...
      
      (at 10.3%), although the level of STR diversity associated with Q1a*-MEH2 is very low, this lineage appears to be closest to the extinct Palaeo-Eskimo individuals belonging to the Saqqaq culture
      Saqqaq culture
      The Saqqaq culture was a Paleo-Eskimo culture in Greenland.-Timeframe:...
      
      arisen in the New World Arctic about 5.5 Ka.
    - Q1a1 (M120, M265/N14) (formerly Q1) — It is so far restricted to East Asia. It has been found at low frequency among Han Chinese
      Han Chinese
      Han Chinese are an ethnic group native to China and are the largest single ethnic group in the world.Han Chinese constitute about 92% of the population of the People's Republic of China , 98% of the population of the Republic of China , 78% of the population of Singapore, and about 20% of the...
      
      , Dungans, Japanese
      Japanese people
      The are an ethnic group originating in the Japanese archipelago and are the predominant ethnic group of Japan. Worldwide, approximately 130 million people are of Japanese descent; of these, approximately 127 million are residents of Japan. People of Japanese ancestry who live in other countries...
      
      , Koreans, and Tibetans. Although it was reported in the Hazaras, it was subsequently shown to be a lab error as demonstrated by the phylogenetic tree changes in Karafet 2008.
    - Q1a2 (M25, M143) (formerly Q2) — Found with low to moderate frequency in Iran
      Iran
      Iran , officially the Islamic Republic of Iran , is a country in Southern and Western Asia. The name "Iran" has been in use natively since the Sassanian era and came into use internationally in 1935, before which the country was known to the Western world as Persia...
      
      , Lebanon
      Lebanon
      Lebanon , officially the Republic of LebanonRepublic of Lebanon is the most common term used by Lebanese government agencies. The term Lebanese Republic, a literal translation of the official Arabic and French names that is not used in today's world. Arabic is the most common language spoken among...
      
      , and Turkey
      Turkey
      Turkey , known officially as the Republic of Turkey , is a Eurasian country located in Western Asia and in East Thrace in Southeastern Europe...
    - Q1a3
      Haplogroup Q1a3 (Y-DNA)
      Haplogroup Q1a3 is a subclade of Y-DNA Haplogroup Q. Haplogroup Q1a3 is defined by the presence of the M346 Single Nucleotide Polymorphism and may therefore be referred to as Q-M346 in shorthand.- Distribution :...
      
      (L56, L57, M346) (called formerly Q4 or Q6) — Found at low frequency in Europe, South Asia and West Asia. Including its Q-M3 subclade, it is the only branch of haplogroup Q found in modern indigenous populations of the Americas. It has been found in Pakistan
      Pakistan
      Pakistan , officially the Islamic Republic of Pakistan is a sovereign state in South Asia. It has a coastline along the Arabian Sea and the Gulf of Oman in the south and is bordered by Afghanistan and Iran in the west, India in the east and China in the far northeast. In the north, Tajikistan...
      
      , Saudi Arabia
      Saudi Arabia
      The Kingdom of Saudi Arabia , commonly known in British English as Saudi Arabia and in Arabic as as-Sa‘ūdiyyah , is the largest state in Western Asia by land area, constituting the bulk of the Arabian Peninsula, and the second-largest in the Arab World...
      
      , the United Arab Emirates
      United Arab Emirates
      The United Arab Emirates, abbreviated as the UAE, or shortened to "the Emirates", is a state situated in the southeast of the Arabian Peninsula in Western Asia on the Persian Gulf, bordering Oman, and Saudi Arabia, and sharing sea borders with Iraq, Kuwait, Bahrain, Qatar, and Iran.The UAE is a...
      
      , India
      India
      India , officially the Republic of India , is a country in South Asia. It is the seventh-largest country by geographical area, the second-most populous country with over 1.2 billion people, and the most populous democracy in the world...
      
      and Tibet.
      - Q1a3a (L53, L54, L55, L213)
        
        Q1a3a1 (M3) (formerly Q3) — Typical of indigenous peoples of the Americas
        Indigenous peoples of the Americas
        The indigenous peoples of the Americas are the pre-Columbian inhabitants of North and South America, their descendants and other ethnic groups who are identified with those peoples. Indigenous peoples are known in Canada as Aboriginal peoples, and in the United States as Native Americans...
        
        Q1a3a1a (M19) — Found among some indigenous peoples of South America
        South America
        South America is a continent situated in the Western Hemisphere, mostly in the Southern Hemisphere, with a relatively small portion in the Northern Hemisphere. The continent is also considered a subcontinent of the Americas. It is bordered on the west by the Pacific Ocean and on the north and east...
        
        , such as the Ticuna and the Wayuu
        Wayuu
        Wayuu is an Amerindian ethnic group of the La Guajira Peninsula in northern Colombia and northwest Venezuela. They are part of the Maipurean language family.- Geography :...
        
        Q1a3a1b (M194) — In South America
        
        Q1a3a1c (M199, P106, P292) — In South America
      - Q1a3b (M323) (called successively Q4, Q6 and Q5) — It has been detected in Yemenite Jews
        Yemenite Jews
        Yemenite Jews are those Jews who live, or whose recent ancestors lived, in Yemen . Between June 1949 and September 1950, the overwhelming majority of Yemen's Jewish population was transported to Israel in Operation Magic Carpet...
        
        .
  - Q1b (L275, L314)
    
    Q1b1 (M378) — It is widely distributed in Europe, South Asia, and West Asia. It is found among samples of Hazaras and Sindhis
    Sindhi people
    Sindhis are a Sindhi speaking socio-ethnic group of people originating from Sindh, a province Formerly of British India, now in Pakistan. Today Sindhis that live in Pakistan belong to various religious denominations including Islam, Zoroastrianism, Hinduism, Sikhism and Christianity...
    
    . It is also found in the Uyghurs
    Uyghur people
    The Uyghur are a Turkic ethnic group living in Eastern and Central Asia. Today, Uyghurs live primarily in the Xinjiang Uyghur Autonomous Region in the People's Republic of China...
    
    of North-Western China
    China
    Chinese civilization may refer to:* China for more general discussion of the country.* Chinese culture* Greater China, the transnational community of ethnic Chinese.* History of China* Sinosphere, the area historically affected by Chinese culture...
    
    in two separate groups. The Q-M378 subclade and specifically its Q-L245 subbranch is speculated to be the branch to which Q-M242 men in Jewish Diaspora populations belong. Although published articles have not tested for M378 in Jewish populations, genetic genealogists
    Genetic genealogy
    Genetic genealogy is the application of genetics to traditional genealogy. Genetic genealogy involves the use of genealogical DNA testing to determine the level of genetic relationship between individuals.-History:...
    
    from the Ashkenazi, Mizrachi
    Mizrahi Jews
    Mizrahi Jews or Mizrahiyim, , also referred to as Adot HaMizrach are Jews descended from the Jewish communities of the Middle East, North Africa and the Caucasus...
    
    , and Sephardi Jewish populations have tested positive for both M378 and L245.

External links

Q Y-Haplogroup Project at FTDNA
American Indian Q3 project at FTDNA
Spread of Haplogroup Q, from The Genographic Project
The Genographic Project
The Genographic Project, launched on April 13, 2005 by the National Geographic Society and IBM, is a multi-year genetic anthropology study that aims to map historical human migration patterns by collecting and analyzing DNA samples from hundreds of thousands of people from around the...

, National Geographic
The India Genealogical DNA Project
British Isles DNA Project

The source of this article is wikipedia, the free encyclopedia. The text of this article is licensed under the GFDL.

Origins

Technical specification of mutation

Subclades

Haplogroup and Subclade Defining SNPs

Phylogenetic naming variations

Phylogenetic Trees

The Genomic Research Center Draft Tree

The Y-Chromosome Consortium 2008 tree

The 2011 ISOGG Tree

Distribution

The Americas

Asia

East Asia

South Asia

West Asia

Europe

Population Frequencies from Studies

Subclade Distribution

See also

External links