Subgenomic mRNA
Encyclopedia
Subgenomic mRNA's are essentially smaller sections of the original transcribed template strand. During transcription
, the original template strand is usually read from the 3' to the 5' end from beginning to end. Subgenomic mRNAs are created when transcription begins at the 3' end of the template strand (or 5' of the to-be-newly synthesized template) and begins to copy towards the 5' end of the template strand before "jumping" to the end of the template and copying the 5' end of the template, creating a 3' tail for the newly created strand. As a result, the newly created strand will have similar 5' ends to varying degrees with the original template (depending on when the transcription began the jump) and similar 3' ends to the template.
The result is many different proteins created from the different lengths of mRNA created from the same strand with similar 5' ends (to varying degrees) and same 3' ends. The similar 5' sections on the newly created strand is a result of the same section being copied from the template strand, and this section on the template strand is referred to as the "nested set".
es, especially those of the single-stranded, positive-sense RNA
or Class IV viruses using the Baltimore Classification System. Its use is primarily used for compacting more genetic
information into a shorter amount of genetic material.
Transcription (genetics)
Transcription is the process of creating a complementary RNA copy of a sequence of DNA. Both RNA and DNA are nucleic acids, which use base pairs of nucleotides as a complementary language that can be converted back and forth from DNA to RNA by the action of the correct enzymes...
, the original template strand is usually read from the 3' to the 5' end from beginning to end. Subgenomic mRNAs are created when transcription begins at the 3' end of the template strand (or 5' of the to-be-newly synthesized template) and begins to copy towards the 5' end of the template strand before "jumping" to the end of the template and copying the 5' end of the template, creating a 3' tail for the newly created strand. As a result, the newly created strand will have similar 5' ends to varying degrees with the original template (depending on when the transcription began the jump) and similar 3' ends to the template.
The result is many different proteins created from the different lengths of mRNA created from the same strand with similar 5' ends (to varying degrees) and same 3' ends. The similar 5' sections on the newly created strand is a result of the same section being copied from the template strand, and this section on the template strand is referred to as the "nested set".
GCCGCCCCGTATCGATCGTAGCGCACGTTATATATACGTTATTTCTGCGCGGAAAAAAAAA - Original Strand
GCCGCCCCGTATCGATCGTAGCGCACGTTATATATAC---------------AAAAAAAAA |
GCCGCCCCGTATCGATCGTAGCGCAC--------------------------AAAAAAAAA | = Subgenomic mRNA. The -'s indicate jumps.
GCCGCCCCGTAT----------------------------------------AAAAAAAAA |
GCCGCCCCGTAT = Nested Set
Examples
This complex method of transcription is generally restricted to virusVirus
A virus is a small infectious agent that can replicate only inside the living cells of organisms. Viruses infect all types of organisms, from animals and plants to bacteria and archaea...
es, especially those of the single-stranded, positive-sense RNA
RNA
Ribonucleic acid , or RNA, is one of the three major macromolecules that are essential for all known forms of life....
or Class IV viruses using the Baltimore Classification System. Its use is primarily used for compacting more genetic
Genetics
Genetics , a discipline of biology, is the science of genes, heredity, and variation in living organisms....
information into a shorter amount of genetic material.