Haplogroup G (Y-DNA)
Encyclopedia
In human genetics
, Haplogroup G (M201) is a Y-chromosome haplogroup
. It is a branch of Haplogroup F (M89). Haplogroup G has an overall low frequency in most populations but is widely distributed within many ethnic groups of the Old World
in Europe
, northern and western Asia
, northern Africa
, the Middle East
, India
, Sri Lanka
and Malaysia.
places haplogroup G origins in the Middle East 30,000 years ago and presumes that people carrying the haplogroup took part in the spread of the Neolithic
Two scholarly papers have also suggested an origin in the Middle East, while differing on the date. Semino et al. (2000) suggested 17,000 years ago. Cinnioglu et al. (2004) suggested the mutation took place only 9,500 years ago.
The oldest skeleton confirmed by ancient DNA
testing as carrying haplogroup G was found at the Neolithic cemetery of Derenburg Meerenstieg II, north central Germany
, with burial artifacts belonging to the Linear Pottery culture
, known in German as Linearbandkeramik (LBK). This skeleton could not be dated by radiocarbon dating
, but other skeletons there were dated to between 5,100 and 6,100 years old. The most detailed SNP mutation identified was S126 (L30), which defines G2a3. G2a was found in 20 out of 22 samples of ancient Y-DNA from Treilles
, the type-site of a Late Neolithic group of farmers in the South of France
, dated around 3000 BCE. Two skeletons carrying haplogroup G2a were found in a high-status burial at Ergolding
in present-day Bavaria
, southern Germany, of the Merovingian dynasty
period.
and was first reported in 2001. The technical specifications of M201 are given as: refSNPid is rs2032636.....Y chromosome location of 13536923....forward primer is tatgcatttgttgagtatatgtc.....reverse primer is gttctgaatgaaagttcaaacg.....the mutation involves a change from G to T.
The following SNPs are so far are identified as M201 equivents: L116, L154, L269, L294, L240, P257, L402, L520, L521, L522, L523, L605, Page 94, U2, U3, U6, U7, U12, U17, U20, U21, U23 and U33. P257 was first reported in 2008. L240 was identified in 2009. The "U" SNPs were identified in 2006 but not published until 2009.
In addition, there are multiple other SNPs thought to have the same coverage as M201. These are found at: rs9786910, rs9786537, rs2713254, rs35567891 and rs34621155 on the Y chromosome. No labs have yet assigned them shorthand names.
G*
The ^ indicates newly identified in 2009-11.
The * indicates negativity for subgroups of that category
The seven most commonly occurring subgroups of haplogroup G in existing data with their corresponding SNPs in parentheses are: G1 (M285), G2a1 (P16) G2a3a (M406), G2a3b1a (L140), G2a3b1a2 (L497), G2a3b1a1a (L13/S131/U13) and G2c (M377).
(P designations), Stanford University
(M designations) or the University of Central Florida
(U designations). Beginning in 2008, additional G SNPs were identified at Family Tree DNA (L designations) and Ethnoancestry (S designations). These latter labs also made use of raw data results reported by individuals tested for about 2,000 SNPs at 23andMe
to provide new L or S-designated SNP tests. In 2009-10, Family Tree DNA's Walk through the Y Project, sequencing certain Y-chromosome segments, provided a number of new G SNPs with the L designation.
Because SNPs provide the most reliable method of categorization, each is allowed to represent an official G category. Categories have alternating letters and numbers. But unusual values or unusual value combinations found at short tandem repeat
markers (STRs) can also provide the basis of additional subgrouping. The identification of a new SNP can necessitate renaming of one or more categories.
(STR) marker DYS392 and all will have the M285 or M342 SNP mutation which characterizes this group. This value of 12 is uncommon in other G categories other than G1.
Subgroups of G1a, G1a1 and G1b exist.
The highest reported concentration of G1 and its subgroups in a single country is in Iran
, with next most frequent concentrations in neighboring countries to the west.
There are distinctive Ashkenazi Jewish and Kazakh
subgroups based on STR marker value combinations.
and became widely known in late 2007. Its identification caused considerable renaming of G categories.
and became widely known by 2002. Its chromosome location listed as 21653414. G2a was found in medieval remains in a 7th- century CE high-status tomb in Ergolding, Bavaria
, Germany.
There are multiple SNPs which so far have the same coverage as P15. They are—with accompanying Y-chromosome locations—U5 (rs2178500), L149 (8486380) and L31 (also called S149) (rs35617575..12538148). Should any man with the P15 mutation test negative (ancestral) for any of these or vice versa, that finding would be the basis of a new G2a category.
area. G2a1 is found only in tiny numbers elsewhere. Almost all G2a1 persons have a value of 10 at STR
marker DYS392. They also typically have higher values for DYS385b, such as 16, 17 or 18, than seen in most G persons.
The North Ossetians in the mid northern Caucasus area of Russia
belong overwhelmingly to the G2a1 subgroup based on available samples.
The presence of the SNP P18 mutation characterizes G2a1's only subgroup, G2a1a. The reliability of both P16 and P18 in identifying everyone in each of these categories has been questioned and individual components of the SNP have to be examined.
Ashkenazi Jewish G2a1 men with northeastern European ancestry form a distinct cluster based on STR marker values. Men from the Caucasus and men from eastern Europe also form distinctive STR clusters.
, known in German as Linearbandkeramik (LBK).
and the coastal areas of the eastern Mediterranean where it can constitute up to 50% of haplogroup G samples. G2a3a is more common in southern Europe than northern Europe. In Europe—except in Italy
—G2a3a constitutes less than 20% of G samples. G2a3a so far has seldom surfaced in northern Africa or southern Asia, but represents a small percentage of the G population in the Caucasus Mountains region and in Iran
.
A relatively high percentage of G2a3a persons have a value of 21 at STR marker DYS390. The DYS391 marker has mostly a value of 10, but sometimes 11, in G2a3a persons, and DYS392 is almost always 11. If a sample meets the criteria indicated for these three markers, it is likely the sample is G2a3a.
G2a3a has one known subgroup. G2a3a1 is relatively common among G2a3a persons.
and Russia
where G2a3b1 is often in the majority among G persons. Small percentages of G2a3b1 are found primarily in the area encompassed by Turkey, the Caucasus countries, Iran and the Middle East where the G2a3b1 SNP may have originated. G2a3b1 is also found in India.
The largest G2a3b1 subgroup based on available samples is one in which almost all persons have the value of 13 at STR marker DYS388. The L497 SNP (G2a3b1a2) encompasses these men. There are additional subgroups of DYS388=13 men characterized by the presence of specific SNPs or uncommon STR marker oddities.
The next largest G2a3b1 subgroup is characterized by the presence of the L13/S13 SNP (G2a3b1a1a). This subgroup is most common in north central Europe.
New testing in 2010 indicated that a substantial G2a3b1 subgroup characterized by having the U1 mutation (G2a3b1a1) exists primarily in the Caucasus Mountains region.
The final major subgroup is characterized in a high percentage of cases by the values of 9 at marker DYS568 and 20,21 at marker YCA. This latter DYS568=9 subgroup contains a further large subgroup consisting overwhelmingly of Ashkenazi Jews
.
The highest percentage of G2a3b1 persons in a discrete population so far described is on the island of Ibiza
off the eastern Spanish coast.
The number of STR marker values separating men in this group suggest G2a3b2 is a relatively old group despite the small number of men involved. The mutations involved are complicated and difficult to interpret. The L177.1 component is found at Y chromosome position 23397163; L177.2 at 25030912; L177.3 at 25750264. This SNP was first identified at Family Tree DNA in 2009.
represent virtually all G2c
persons, with just three other G2c haplotypes having been reported so far: one Turk
from Kars
in northeast Turkey near Armenia, one Pashtun
, and one Burusho in Pakistan. The extreme rarity of G2c in northern Pakistan could indicate that G2c in this area originates outside the region and was brought there in the historic period, perhaps from further west (Pakistan was part of both the Achaemenid Persian Empire, conquered by Alexander the Great, and then formed a part of the Greco-Bactrian Kingdom). These two reported Pakistani G2c haplotypes are quite divergent from the Ashkenazi Jewish clade, and therefore do not at all indicate a recent common origin. The Turkish G2c is somewhat closer, but not identical. It remains to be seen if testing will reveal G2c haplotypes in other populations — this is some indication that G2c occurs at low levels in the Near East. Early reports that Ashkenazi G men were all G1 are now proven incorrect. There are also Jewish genetic clades within G2 and G1 whose members are not closely related to the G2c men. All G2c men tested so far have a rare null value for the DYS
425 marker, (a missing "T" allele of the DYS371 palindromic STR), the result of a RecLOH
event, a finding not yet seen among most other G haplotypes. Among Jews in Israel drawn from many areas of the world, G2c constituted 3.7% in one study.
In Europe west of the Black Sea
Haplogroup G is found at about 5% of the population on average throughout most of the continent. The concentration of G falls below this average in Scandinavia
, the westernmost former Soviet republics and Poland
, as well as in Iceland
and the British Isles
. There are seeming pockets of unusual concentrations within Europe. In Wales
, a distinctive G2a3b1 type (DYS388=13 and DYS594=11) dominates there and pushes the G percentage of the population higher than in England. In western Austria
, in the Tirol
(Tyrol) the G percentage can reach 8% or more. In the northern and highland areas of the island of Sardinia
off western Italy
, G percentages reach 11% of the population in one study and reached 21% in the town of Tempio in another study. In the Greek island of Crete
, approximately 7% to 11% of males belong to haplogroup G.
In north-eastern Croatia
, in the town of Osijek
, G was found in 14% of the males. The city is on the banks of the river Drava
, which notably begins in the Tirol/Tyrol region of the Alps, another haplogroup G focus area in Europe. Farther north, 8% of ethnic Hungarian males and 5.1% of ethnic Bohemian (Czech) males have been
found to belong to Haplogroup G.
In Russia, the Ukraine and central Asia, the G percentage is around 1% or less. The northern slope of the Caucasus Mountains
represents a major exception where concentrations in the Kabardinian and Ossetian
populations are noted. In Digora
, North Ossetia the highest known concentration of G in a single town in the world is reached where 74% of the tested men were G. The Madyars of central Kazakhstan
, a Kazakh sub-ethnic group, were found to be 87% G1. Haplogroup G is found as far east as northern China in small percentages where G can reach more substantial percentages in minority groups such as the Uyghurs.
In Turkey, the southern Caucasus region and Iran, haplogroup G reaches the highest percentage of a regional population worldwide. Among Turkish
males 11% of the population is G. In Iran, Haplogroup G reaches 13 to 15% of the population in various parts of the country. While it is found in percentages higher than 10% among the Bakhtiari, Gilaki and Mazandarani
, it is closer to 5% among the Iranian Arabs and in some large cities. Among the samples in the YHRD database from the southern Caucasus countries, 29% of the samples from Abazinia
, 31% from Georgia
, 18% from Azerbaijan
and 11% from Armenia
appear to be G samples.
In southern Asia, haplogroup G is found in concentrations of approximately 18% to 20% of Kalash
, approximately 16% of Brahui
, and approximately 11.5% of sampled Pashtun
, but in only about 3% of the general Pakistan
i population. The many groups in India
and Bangla Desh have not been well studied. About 6% of the samples from Sri Lanka
and Malaysia were reported as haplogroup G, but none were found in the other coastal lands of the Indian Ocean
or Pacific Ocean
in Asia.
In the Middle East, haplogroup G accounts for about 3% of the population in almost all areas. Among the Druze
mostly residents of Israel
10% were found to be haplogroup G.
In Africa, haplogroup G is rarely found in sub-Saharan Africa
or south of the horn of Africa
among native populations. In Egypt
, studies have provided information that pegs the G percentage there to be between 2% and 9%. Three percent of North African Berbers
were found to be haplogroup G. Two percent of Arab Moroccans and 8% of Berber Moroccans were likewise found to be G.
In the Americas, the percentage of haplogroup G corresponds to the numbers of persons from Old World countries who emigrated. It is not found among Native Americans
except where intermarriage with non-native persons has occurred.
Around 10% of Jewish
males are Haplogroup G.
, from a genetic test on his grandson (his son Vasily's son; Alexander Burdonsky), shows his Y-DNA haplogroup to be G2a1a http://www.runewsweek.ru/theme/?tid=96&rid=1567
King Louis XVI of France
from a genetic test on blood in a cloth purported to have been collected at his beheading and maintained in an ornate gourd decorated with French Revolution
themes. Confirmation of this genetic profile requires testing of a known relative. The sample was tested at two laboratories with the same results. The sample is most consistent with G2a3b1a samples and contains unusually high, rare values for markers DYS385B and DYS458 within this G subgroup.
Other notables purported to belong to haplogroup G include American historical figures Phillip Hamman
and Linn Banks
(U.S. Representative from Virginia),
physicist John G. Cramer
, actor James Franciscus
, and former Chairman of the United States Federal Communications Commission
(FCC) and Chairman of the Public Broadcasting Service
, Newton Minow.
Human genetics
Human genetics describes the study of inheritance as it occurs in human beings. Human genetics encompasses a variety of overlapping fields including: classical genetics, cytogenetics, molecular genetics, biochemical genetics, genomics, population genetics, developmental genetics, clinical genetics,...
, Haplogroup G (M201) is a Y-chromosome haplogroup
Haplogroup
In the study of molecular evolution, a haplogroup is a group of similar haplotypes that share a common ancestor having the same single nucleotide polymorphism mutation in both haplotypes. Because a haplogroup consists of similar haplotypes, this is what makes it possible to predict a haplogroup...
. It is a branch of Haplogroup F (M89). Haplogroup G has an overall low frequency in most populations but is widely distributed within many ethnic groups of the Old World
Old World
The Old World consists of those parts of the world known to classical antiquity and the European Middle Ages. It is used in the context of, and contrast with, the "New World" ....
in Europe
Europe
Europe is, by convention, one of the world's seven continents. Comprising the westernmost peninsula of Eurasia, Europe is generally 'divided' from Asia to its east by the watershed divides of the Ural and Caucasus Mountains, the Ural River, the Caspian and Black Seas, and the waterways connecting...
, northern and western Asia
Asia
Asia is the world's largest and most populous continent, located primarily in the eastern and northern hemispheres. It covers 8.7% of the Earth's total surface area and with approximately 3.879 billion people, it hosts 60% of the world's current human population...
, northern Africa
Africa
Africa is the world's second largest and second most populous continent, after Asia. At about 30.2 million km² including adjacent islands, it covers 6% of the Earth's total surface area and 20.4% of the total land area...
, the Middle East
Middle East
The Middle East is a region that encompasses Western Asia and Northern Africa. It is often used as a synonym for Near East, in opposition to Far East...
, India
India
India , officially the Republic of India , is a country in South Asia. It is the seventh-largest country by geographical area, the second-most populous country with over 1.2 billion people, and the most populous democracy in the world...
, Sri Lanka
Sri Lanka
Sri Lanka, officially the Democratic Socialist Republic of Sri Lanka is a country off the southern coast of the Indian subcontinent. Known until 1972 as Ceylon , Sri Lanka is an island surrounded by the Indian Ocean, the Gulf of Mannar and the Palk Strait, and lies in the vicinity of India and the...
and Malaysia.
Origins
Various estimated dates and locations have been proposed for the origin of Haplogroup G. The National Geographic SocietyNational Geographic Society
The National Geographic Society , headquartered in Washington, D.C. in the United States, is one of the largest non-profit scientific and educational institutions in the world. Its interests include geography, archaeology and natural science, the promotion of environmental and historical...
places haplogroup G origins in the Middle East 30,000 years ago and presumes that people carrying the haplogroup took part in the spread of the Neolithic
Neolithic
The Neolithic Age, Era, or Period, or New Stone Age, was a period in the development of human technology, beginning about 9500 BC in some parts of the Middle East, and later in other parts of the world. It is traditionally considered as the last part of the Stone Age...
Two scholarly papers have also suggested an origin in the Middle East, while differing on the date. Semino et al. (2000) suggested 17,000 years ago. Cinnioglu et al. (2004) suggested the mutation took place only 9,500 years ago.
The oldest skeleton confirmed by ancient DNA
Ancient DNA
Ancient DNA is DNA isolated from ancient specimens. It can be also loosely described as any DNA recovered from biological samples that have not been preserved specifically for later DNA analyses...
testing as carrying haplogroup G was found at the Neolithic cemetery of Derenburg Meerenstieg II, north central Germany
Germany
Germany , officially the Federal Republic of Germany , is a federal parliamentary republic in Europe. The country consists of 16 states while the capital and largest city is Berlin. Germany covers an area of 357,021 km2 and has a largely temperate seasonal climate...
, with burial artifacts belonging to the Linear Pottery culture
Linear Pottery culture
The Linear Pottery culture is a major archaeological horizon of the European Neolithic, flourishing ca. 5500–4500 BC.It is abbreviated as LBK , is also known as the Linear Band Ware, Linear Ware, Linear Ceramics or Incised Ware culture, and falls within the Danubian I culture of V...
, known in German as Linearbandkeramik (LBK). This skeleton could not be dated by radiocarbon dating
Radiocarbon dating
Radiocarbon dating is a radiometric dating method that uses the naturally occurring radioisotope carbon-14 to estimate the age of carbon-bearing materials up to about 58,000 to 62,000 years. Raw, i.e. uncalibrated, radiocarbon ages are usually reported in radiocarbon years "Before Present" ,...
, but other skeletons there were dated to between 5,100 and 6,100 years old. The most detailed SNP mutation identified was S126 (L30), which defines G2a3. G2a was found in 20 out of 22 samples of ancient Y-DNA from Treilles
Treilles
Treilles is a commune in the Aude department in southern France.-Population:...
, the type-site of a Late Neolithic group of farmers in the South of France
France
The French Republic , The French Republic , The French Republic , (commonly known as France , is a unitary semi-presidential republic in Western Europe with several overseas territories and islands located on other continents and in the Indian, Pacific, and Atlantic oceans. Metropolitan France...
, dated around 3000 BCE. Two skeletons carrying haplogroup G2a were found in a high-status burial at Ergolding
Ergolding
Ergolding is a municipality in the district of Landshut, in Bavaria, Germany. It is situated on the left bank of the Isar, 5 km northeast of Landshut....
in present-day Bavaria
Bavaria
Bavaria, formally the Free State of Bavaria is a state of Germany, located in the southeast of Germany. With an area of , it is the largest state by area, forming almost 20% of the total land area of Germany...
, southern Germany, of the Merovingian dynasty
Merovingian dynasty
The Merovingians were a Salian Frankish dynasty that came to rule the Franks in a region largely corresponding to ancient Gaul from the middle of the 5th century. Their politics involved frequent civil warfare among branches of the family...
period.
M201 SNP Mutation
The M201 SNP mutation that characterizes haplogroup G was identified at Stanford UniversityStanford University
The Leland Stanford Junior University, commonly referred to as Stanford University or Stanford, is a private research university on an campus located near Palo Alto, California. It is situated in the northwestern Santa Clara Valley on the San Francisco Peninsula, approximately northwest of San...
and was first reported in 2001. The technical specifications of M201 are given as: refSNPid is rs2032636.....Y chromosome location of 13536923....forward primer is tatgcatttgttgagtatatgtc.....reverse primer is gttctgaatgaaagttcaaacg.....the mutation involves a change from G to T.
Equivalent SNP Mutations
A number of SNPs have been identified with seemingly the same coverage in the population as M201. Because M201 was identified first, it is the standard SNP test used when testing for G persons. In order to determine if one of these alternative SNPs represents a subgroup of M201, the alternative SNPs must be tested in G persons who are negative for the known subgroups of G. There are only a tiny number of persons in such a category, and only a tiny number of persons have been tested for G equivalent SNPs other than M201.The following SNPs are so far are identified as M201 equivents: L116, L154, L269, L294, L240, P257, L402, L520, L521, L522, L523, L605, Page 94, U2, U3, U6, U7, U12, U17, U20, U21, U23 and U33. P257 was first reported in 2008. L240 was identified in 2009. The "U" SNPs were identified in 2006 but not published until 2009.
In addition, there are multiple other SNPs thought to have the same coverage as M201. These are found at: rs9786910, rs9786537, rs2713254, rs35567891 and rs34621155 on the Y chromosome. No labs have yet assigned them shorthand names.
Subgroup Tree Listing
.............corresponding SNP IDs listed in parenthesesG*
- G1 (M285, M342)
- G1* -
- G1a (P20.1, P20.2, P20.3)
- G1a*
- G1a1 (L201^, L202^, L203^)
- G1a*
- G1b (P76)
- G1a (P20.1, P20.2, P20.3)
- G1* -
- G2 (P287)
- G2* -
- G2a (P15, U5, L31/S149, L149^)
- G2a* -
- G2a1 (P16.1, P16.2)
- G2a1* -
- G2a1a (P18.1, P18.2, P18.3)
- G2a1* -
- G2a2 (M286)
- G2a3 (L30/S126, L32/S148)
- G2a3* -
- G2a3a (M406)
- G2a3a* -
- G2a3a1 (L14/S130/U16, L90/S133)
- G2a3a2 (L645^)
- G2a3a* -
- G2a3b (L141.1^)
- G2a3b* -
- G2a3b1 (P303/S135)
- G2a3b1* -
- G2a3b1a (L140^)
- G2a3b1a*
- G2a3b1a1 (U1)
- G2a3b1a1*
- G2a3b1a1a (L13/S131/U13, L78)
- G2a3b1a1*
- G2a3b1a2 (L497)^
- G2a3b1a2*
- G2a3b1a2a (L43/S147)
- G2a3b1a2a*
- G2a3b1a2a1 (L42/S146)
- G2a3b1a2a*
- G2a3b1a2a (L43/S147)
- G2a3b1a3 (L640^)
- G2a3b1a4 (L660^, L662^)
- G2a3b1a2*
- G2a3b1a1 (U1)
- G2a3b1a*
- G2a3b1b (L694^)
- G2a3b1a (L140^)
- G2a3b1* -
- G2a3b2 (L177.1^, L177.2^, L177.3^)
- G2a3b1 (P303/S135)
- G2a3b* -
- G2a3a (M406)
- G2a3* -
- G2a4 (L91^)
- G2a5 (L293^)
- G2a1 (P16.1, P16.2)
- G2a* -
- G2b (M287)
- G2cHaplogroup G2c (Y-DNA)In human genetics, Haplogroup G2c is a Y-chromosome haplogroup and is defined by the presence of the M377 mutation. It is a branch of Haplogroup G, which in turn is defined by the presence of the M201 mutation....
(M377, L72, L183^)- G2c* -
- G2c1 (M283)
- G2c* -
The ^ indicates newly identified in 2009-11.
The * indicates negativity for subgroups of that category
The seven most commonly occurring subgroups of haplogroup G in existing data with their corresponding SNPs in parentheses are: G1 (M285), G2a1 (P16) G2a3a (M406), G2a3b1a (L140), G2a3b1a2 (L497), G2a3b1a1a (L13/S131/U13) and G2c (M377).
Characteristics of Haplogroup G Subgroups
The International Society of Genetic Genealogy (ISOGG) maintains the most up-to-date consensus version of haplogroup categories. These classifications are based on shared SNP mutations. The discovery of new SNPs can result in assignment of new names to haplogroup categories. There were only a few G categories until 2008 when major revisions to categories were made. Even more G SNPs were identified in 2009 to 2011 leading to more changes. Until 2008, new G SNPs were reported from labs at the University of ArizonaUniversity of Arizona
The University of Arizona is a land-grant and space-grant public institution of higher education and research located in Tucson, Arizona, United States. The University of Arizona was the first university in the state of Arizona, founded in 1885...
(P designations), Stanford University
Stanford University
The Leland Stanford Junior University, commonly referred to as Stanford University or Stanford, is a private research university on an campus located near Palo Alto, California. It is situated in the northwestern Santa Clara Valley on the San Francisco Peninsula, approximately northwest of San...
(M designations) or the University of Central Florida
University of Central Florida
The University of Central Florida, commonly referred to as UCF, is a metropolitan public research university located in Orlando, Florida, United States...
(U designations). Beginning in 2008, additional G SNPs were identified at Family Tree DNA (L designations) and Ethnoancestry (S designations). These latter labs also made use of raw data results reported by individuals tested for about 2,000 SNPs at 23andMe
23andMe
23andMe is a privately held personal genomics and biotechnology company based in Mountain View, California that is developing new methods and technologies that will enable consumers to understand their own genetic information...
to provide new L or S-designated SNP tests. In 2009-10, Family Tree DNA's Walk through the Y Project, sequencing certain Y-chromosome segments, provided a number of new G SNPs with the L designation.
Because SNPs provide the most reliable method of categorization, each is allowed to represent an official G category. Categories have alternating letters and numbers. But unusual values or unusual value combinations found at short tandem repeat
Short tandem repeat
A short tandem repeat in DNA occurs when a pattern of two or more nucleotides are repeated and the repeated sequences are directly adjacent to each other. The pattern can range in length from 2 to 5 base pairs and is typically in the non-coding intron region...
markers (STRs) can also provide the basis of additional subgrouping. The identification of a new SNP can necessitate renaming of one or more categories.
G1 (M285+ or M342+) and its subgroups
Almost all haplogroup G1 persons have the value of 12 at short tandem repeatShort tandem repeat
A short tandem repeat in DNA occurs when a pattern of two or more nucleotides are repeated and the repeated sequences are directly adjacent to each other. The pattern can range in length from 2 to 5 base pairs and is typically in the non-coding intron region...
(STR) marker DYS392 and all will have the M285 or M342 SNP mutation which characterizes this group. This value of 12 is uncommon in other G categories other than G1.
Subgroups of G1a, G1a1 and G1b exist.
The highest reported concentration of G1 and its subgroups in a single country is in Iran
Iran
Iran , officially the Islamic Republic of Iran , is a country in Southern and Western Asia. The name "Iran" has been in use natively since the Sassanian era and came into use internationally in 1935, before which the country was known to the Western world as Persia...
, with next most frequent concentrations in neighboring countries to the west.
There are distinctive Ashkenazi Jewish and Kazakh
Kazakhs
The Kazakhs are a Turkic people of the northern parts of Central Asia ....
subgroups based on STR marker value combinations.
G2 (P287+)
Men who belong to this group but are negative for all G2 subgroups represent a small number of haplogroup G men. P287 was identified at the University of ArizonaUniversity of Arizona
The University of Arizona is a land-grant and space-grant public institution of higher education and research located in Tucson, Arizona, United States. The University of Arizona was the first university in the state of Arizona, founded in 1885...
and became widely known in late 2007. Its identification caused considerable renaming of G categories.
G2a (P15+)
Haplogroup G men who belong to this group, but are negative for all G2a subgroups, are uncommon in Europe but may represent a sizeable group in so far poorly tested areas east of Turkey. P15 was identified at the University of ArizonaUniversity of Arizona
The University of Arizona is a land-grant and space-grant public institution of higher education and research located in Tucson, Arizona, United States. The University of Arizona was the first university in the state of Arizona, founded in 1885...
and became widely known by 2002. Its chromosome location listed as 21653414. G2a was found in medieval remains in a 7th- century CE high-status tomb in Ergolding, Bavaria
Bavaria
Bavaria, formally the Free State of Bavaria is a state of Germany, located in the southeast of Germany. With an area of , it is the largest state by area, forming almost 20% of the total land area of Germany...
, Germany.
There are multiple SNPs which so far have the same coverage as P15. They are—with accompanying Y-chromosome locations—U5 (rs2178500), L149 (8486380) and L31 (also called S149) (rs35617575..12538148). Should any man with the P15 mutation test negative (ancestral) for any of these or vice versa, that finding would be the basis of a new G2a category.
G2a1 (P16+) and its subgroup
Haplogroup G2a1 and its one subgroup G2a1a represent the majority of haplogroup G samples in some parts of the Caucasus MountainsCaucasus Mountains
The Caucasus Mountains is a mountain system in Eurasia between the Black Sea and the Caspian Sea in the Caucasus region .The Caucasus Mountains includes:* the Greater Caucasus Mountain Range and* the Lesser Caucasus Mountains....
area. G2a1 is found only in tiny numbers elsewhere. Almost all G2a1 persons have a value of 10 at STR
STR
STR, StR, Str or str may stand for:*Short tandem repeat, in DNA testing*Special Theory of Relativity, Einstein's theory*S. T...
marker DYS392. They also typically have higher values for DYS385b, such as 16, 17 or 18, than seen in most G persons.
The North Ossetians in the mid northern Caucasus area of Russia
Russia
Russia or , officially known as both Russia and the Russian Federation , is a country in northern Eurasia. It is a federal semi-presidential republic, comprising 83 federal subjects...
belong overwhelmingly to the G2a1 subgroup based on available samples.
The presence of the SNP P18 mutation characterizes G2a1's only subgroup, G2a1a. The reliability of both P16 and P18 in identifying everyone in each of these categories has been questioned and individual components of the SNP have to be examined.
Ashkenazi Jewish G2a1 men with northeastern European ancestry form a distinct cluster based on STR marker values. Men from the Caucasus and men from eastern Europe also form distinctive STR clusters.
G2a2 (M286+)
This group is tiny. Samples indicating British Isles and Turkish ancestry have been identified. The British samples have distinctive inconsistent double values for STR marker DYS19 in many cases.G2a3 (L30+, S126+, U8+)
Men who belong to this group but are negative for all its subgroups represent a small number today. This haplogroup was found in a Neolithic skeleton from around 5000 BC, in the cemetery of Derenburg Meerenstieg II, Germany, which forms part of the Linear Pottery cultureLinear Pottery culture
The Linear Pottery culture is a major archaeological horizon of the European Neolithic, flourishing ca. 5500–4500 BC.It is abbreviated as LBK , is also known as the Linear Band Ware, Linear Ware, Linear Ceramics or Incised Ware culture, and falls within the Danubian I culture of V...
, known in German as Linearbandkeramik (LBK).
G2a3a (M406+) and its subgroups
G2a3a and its several subgroups seem most commonly found in TurkeyTurkey
Turkey , known officially as the Republic of Turkey , is a Eurasian country located in Western Asia and in East Thrace in Southeastern Europe...
and the coastal areas of the eastern Mediterranean where it can constitute up to 50% of haplogroup G samples. G2a3a is more common in southern Europe than northern Europe. In Europe—except in Italy
Italy
Italy , officially the Italian Republic languages]] under the European Charter for Regional or Minority Languages. In each of these, Italy's official name is as follows:;;;;;;;;), is a unitary parliamentary republic in South-Central Europe. To the north it borders France, Switzerland, Austria and...
—G2a3a constitutes less than 20% of G samples. G2a3a so far has seldom surfaced in northern Africa or southern Asia, but represents a small percentage of the G population in the Caucasus Mountains region and in Iran
Iran
Iran , officially the Islamic Republic of Iran , is a country in Southern and Western Asia. The name "Iran" has been in use natively since the Sassanian era and came into use internationally in 1935, before which the country was known to the Western world as Persia...
.
A relatively high percentage of G2a3a persons have a value of 21 at STR marker DYS390. The DYS391 marker has mostly a value of 10, but sometimes 11, in G2a3a persons, and DYS392 is almost always 11. If a sample meets the criteria indicated for these three markers, it is likely the sample is G2a3a.
G2a3a has one known subgroup. G2a3a1 is relatively common among G2a3a persons.
G2a3b (L141+)
The SNP that defines this group was identified only in mid-2009 at Family Tree DNA, handicapping the ability to describe the features of this group. Initial testing seems to indicate this is a significant G group. Samples from persons with British Isles, Sicilian and Turkish ancestry have been identified. L141+ persons who do not belong to any L141 subgroup so far have the value of 11 at STR marker DYS490 — a finding rare in other G categories. The mutation is found on the Y chromosome at 2948607. The L141 mutation involves an insertion.G2a3b1 (P303+ or S135+) and its subgroups
The G2a3b1 definable subgroups are heavily concentrated throughout Europe west of the Black SeaBlack Sea
The Black Sea is bounded by Europe, Anatolia and the Caucasus and is ultimately connected to the Atlantic Ocean via the Mediterranean and the Aegean seas and various straits. The Bosphorus strait connects it to the Sea of Marmara, and the strait of the Dardanelles connects that sea to the Aegean...
and Russia
Russia
Russia or , officially known as both Russia and the Russian Federation , is a country in northern Eurasia. It is a federal semi-presidential republic, comprising 83 federal subjects...
where G2a3b1 is often in the majority among G persons. Small percentages of G2a3b1 are found primarily in the area encompassed by Turkey, the Caucasus countries, Iran and the Middle East where the G2a3b1 SNP may have originated. G2a3b1 is also found in India.
The largest G2a3b1 subgroup based on available samples is one in which almost all persons have the value of 13 at STR marker DYS388. The L497 SNP (G2a3b1a2) encompasses these men. There are additional subgroups of DYS388=13 men characterized by the presence of specific SNPs or uncommon STR marker oddities.
The next largest G2a3b1 subgroup is characterized by the presence of the L13/S13 SNP (G2a3b1a1a). This subgroup is most common in north central Europe.
New testing in 2010 indicated that a substantial G2a3b1 subgroup characterized by having the U1 mutation (G2a3b1a1) exists primarily in the Caucasus Mountains region.
The final major subgroup is characterized in a high percentage of cases by the values of 9 at marker DYS568 and 20,21 at marker YCA. This latter DYS568=9 subgroup contains a further large subgroup consisting overwhelmingly of Ashkenazi Jews
Ashkenazi Jews
Ashkenazi Jews, also known as Ashkenazic Jews or Ashkenazim , are the Jews descended from the medieval Jewish communities along the Rhine in Germany from Alsace in the south to the Rhineland in the north. Ashkenaz is the medieval Hebrew name for this region and thus for Germany...
.
The highest percentage of G2a3b1 persons in a discrete population so far described is on the island of Ibiza
Ibiza
Ibiza or Eivissa is a Spanish island in the Mediterranean Sea 79 km off the coast of the city of Valencia in Spain. It is the third largest of the Balearic Islands, an autonomous community of Spain. With Formentera, it is one of the two Pine Islands or Pityuses. Its largest cities are Ibiza...
off the eastern Spanish coast.
G2a3b2 (L177+)
This G2a3b2 group is certainly smaller in numbers of men included than G2a3b1, but only a small amount of testing has occurred for the L177 mutations. So far the men positive for this have listed Irish, English, Dutch and Turkish (Armenian surname) ancestry. Several L177 subgroups based on shared STR marker oddities exist.The number of STR marker values separating men in this group suggest G2a3b2 is a relatively old group despite the small number of men involved. The mutations involved are complicated and difficult to interpret. The L177.1 component is found at Y chromosome position 23397163; L177.2 at 25030912; L177.3 at 25750264. This SNP was first identified at Family Tree DNA in 2009.
G2a4 (L91+)
The L91 SNP that characterizes this group was identified only in spring 2009 at Family Tree DNA. G2a4 would seem to encompass a significant group of G persons, but the recent identification and the paucity of samples are obstacles to describing characteristics of this group. L91 is found so far in scattered parts of Europe and North Africa. Included within G2a4 are some men with double values for STR marker DYS19, but there are also G2a men with this finding who are not G2a4. The double 19 value situation is not seen in the G2a1 and G2a3 subgroups. The L91 mutation is found at 21327383 on the Y-chromosome, rs35474563. The forward primer is GTATTGAACTTACAATTCACGTCCC, and the reverse is CTCTCCAAATCGGGTTTCCT. The mutation involves a change from C to T. L91+ men have shown varying results for the L223 SNP which will likely define a new G2a4 category when initial testing is completed. L223 is found on the Y chromosome at rs13304806.G2a5 (L293+)
The L293 SNP that characterizes this group was identified in June 2010 at Family Tree DNA. Because of the recent discovery, it is yet to be determined if this SNP is familial or has broader coverage. The mutation is found on the Y chromosome at 10595022. The mutation is a C.G2b (M287+)
The M287 SNP that characterizes this group was published in 2004 and involved a single Turkish man. So far additional G2b samples have not surfaced in the major commercial labs, and there has been discussion as to whether this category should be retained without evidence this SNP has coverage beyond the family of the original test subject.G2c (M377+) and its subgroup
A clade of closely related Ashkenazi JewsAshkenazi Jews
Ashkenazi Jews, also known as Ashkenazic Jews or Ashkenazim , are the Jews descended from the medieval Jewish communities along the Rhine in Germany from Alsace in the south to the Rhineland in the north. Ashkenaz is the medieval Hebrew name for this region and thus for Germany...
represent virtually all G2c
Haplogroup G2c (Y-DNA)
In human genetics, Haplogroup G2c is a Y-chromosome haplogroup and is defined by the presence of the M377 mutation. It is a branch of Haplogroup G, which in turn is defined by the presence of the M201 mutation....
persons, with just three other G2c haplotypes having been reported so far: one Turk
Turkish people
Turkish people, also known as the "Turks" , are an ethnic group primarily living in Turkey and in the former lands of the Ottoman Empire where Turkish minorities had been established in Bulgaria, Cyprus, Bosnia and Herzegovina, Georgia, Greece, Kosovo, Macedonia, and Romania...
from Kars
Kars
Kars is a city in northeast Turkey and the capital of Kars Province. The population of the city is 73,826 as of 2010.-Etymology:As Chorzene, the town appears in Roman historiography as part of ancient Armenia...
in northeast Turkey near Armenia, one Pashtun
Pashtun people
Pashtuns or Pathans , also known as ethnic Afghans , are an Eastern Iranic ethnic group with populations primarily between the Hindu Kush mountains in Afghanistan and the Indus River in Pakistan...
, and one Burusho in Pakistan. The extreme rarity of G2c in northern Pakistan could indicate that G2c in this area originates outside the region and was brought there in the historic period, perhaps from further west (Pakistan was part of both the Achaemenid Persian Empire, conquered by Alexander the Great, and then formed a part of the Greco-Bactrian Kingdom). These two reported Pakistani G2c haplotypes are quite divergent from the Ashkenazi Jewish clade, and therefore do not at all indicate a recent common origin. The Turkish G2c is somewhat closer, but not identical. It remains to be seen if testing will reveal G2c haplotypes in other populations — this is some indication that G2c occurs at low levels in the Near East. Early reports that Ashkenazi G men were all G1 are now proven incorrect. There are also Jewish genetic clades within G2 and G1 whose members are not closely related to the G2c men. All G2c men tested so far have a rare null value for the DYS
DYS
DYS can mean the following:*DYS — a straight edge band, or their self-titled album DYS*Department of Youth Services*Dys, Poland*the 3-letter abbreviation for Dystos, a Greek municipality...
425 marker, (a missing "T" allele of the DYS371 palindromic STR), the result of a RecLOH
RecLOH
RecLOH is a term in genetics that is an abbreviation for "Recombinational Loss of Heterozygosity".This is a type of mutation which occurs with DNA by recombination. From a pair of equivalent , but slightly different genes, a pair of identical genes results...
event, a finding not yet seen among most other G haplotypes. Among Jews in Israel drawn from many areas of the world, G2c constituted 3.7% in one study.
Geographical Distribution
Knowing the distribution of haplogroup G in general is not as useful as that of the distribution of its subgroups. The subgroups likely spread to new areas of the world in different time periods and to different locations. All available G samples derive from studies or collections that do not meet criteria for random sampling, and conclusions based on them are only rough approximations of what is seen in populations.In Europe west of the Black Sea
Black Sea
The Black Sea is bounded by Europe, Anatolia and the Caucasus and is ultimately connected to the Atlantic Ocean via the Mediterranean and the Aegean seas and various straits. The Bosphorus strait connects it to the Sea of Marmara, and the strait of the Dardanelles connects that sea to the Aegean...
Haplogroup G is found at about 5% of the population on average throughout most of the continent. The concentration of G falls below this average in Scandinavia
Scandinavia
Scandinavia is a cultural, historical and ethno-linguistic region in northern Europe that includes the three kingdoms of Denmark, Norway and Sweden, characterized by their common ethno-cultural heritage and language. Modern Norway and Sweden proper are situated on the Scandinavian Peninsula,...
, the westernmost former Soviet republics and Poland
Poland
Poland , officially the Republic of Poland , is a country in Central Europe bordered by Germany to the west; the Czech Republic and Slovakia to the south; Ukraine, Belarus and Lithuania to the east; and the Baltic Sea and Kaliningrad Oblast, a Russian exclave, to the north...
, as well as in Iceland
Iceland
Iceland , described as the Republic of Iceland, is a Nordic and European island country in the North Atlantic Ocean, on the Mid-Atlantic Ridge. Iceland also refers to the main island of the country, which contains almost all the population and almost all the land area. The country has a population...
and the British Isles
British Isles
The British Isles are a group of islands off the northwest coast of continental Europe that include the islands of Great Britain and Ireland and over six thousand smaller isles. There are two sovereign states located on the islands: the United Kingdom of Great Britain and Northern Ireland and...
. There are seeming pockets of unusual concentrations within Europe. In Wales
Wales
Wales is a country that is part of the United Kingdom and the island of Great Britain, bordered by England to its east and the Atlantic Ocean and Irish Sea to its west. It has a population of three million, and a total area of 20,779 km²...
, a distinctive G2a3b1 type (DYS388=13 and DYS594=11) dominates there and pushes the G percentage of the population higher than in England. In western Austria
Austria
Austria , officially the Republic of Austria , is a landlocked country of roughly 8.4 million people in Central Europe. It is bordered by the Czech Republic and Germany to the north, Slovakia and Hungary to the east, Slovenia and Italy to the south, and Switzerland and Liechtenstein to the...
, in the Tirol
Tyrol (state)
Tyrol is a state or Bundesland, located in the west of Austria. It comprises the Austrian part of the historical region of Tyrol.The state is split into two parts–called North Tyrol and East Tyrol–by a -wide strip of land where the state of Salzburg borders directly on the Italian province of...
(Tyrol) the G percentage can reach 8% or more. In the northern and highland areas of the island of Sardinia
Sardinia
Sardinia is the second-largest island in the Mediterranean Sea . It is an autonomous region of Italy, and the nearest land masses are the French island of Corsica, the Italian Peninsula, Sicily, Tunisia and the Spanish Balearic Islands.The name Sardinia is from the pre-Roman noun *sard[],...
off western Italy
Italy
Italy , officially the Italian Republic languages]] under the European Charter for Regional or Minority Languages. In each of these, Italy's official name is as follows:;;;;;;;;), is a unitary parliamentary republic in South-Central Europe. To the north it borders France, Switzerland, Austria and...
, G percentages reach 11% of the population in one study and reached 21% in the town of Tempio in another study. In the Greek island of Crete
Crete
Crete is the largest and most populous of the Greek islands, the fifth largest island in the Mediterranean Sea, and one of the thirteen administrative regions of Greece. It forms a significant part of the economy and cultural heritage of Greece while retaining its own local cultural traits...
, approximately 7% to 11% of males belong to haplogroup G.
In north-eastern Croatia
Croatia
Croatia , officially the Republic of Croatia , is a unitary democratic parliamentary republic in Europe at the crossroads of the Mitteleuropa, the Balkans, and the Mediterranean. Its capital and largest city is Zagreb. The country is divided into 20 counties and the city of Zagreb. Croatia covers ...
, in the town of Osijek
Osijek
Osijek is the fourth largest city in Croatia with a population of 83,496 in 2011. It is the largest city and the economic and cultural centre of the eastern Croatian region of Slavonia, as well as the administrative centre of Osijek-Baranja county...
, G was found in 14% of the males. The city is on the banks of the river Drava
Drava
Drava or Drave is a river in southern Central Europe, a tributary of the Danube. It sources in Toblach/Dobbiaco, Italy, and flows east through East Tirol and Carinthia in Austria, into Slovenia , and then southeast, passing through Croatia and forming most of the border between Croatia and...
, which notably begins in the Tirol/Tyrol region of the Alps, another haplogroup G focus area in Europe. Farther north, 8% of ethnic Hungarian males and 5.1% of ethnic Bohemian (Czech) males have been
found to belong to Haplogroup G.
In Russia, the Ukraine and central Asia, the G percentage is around 1% or less. The northern slope of the Caucasus Mountains
Caucasus Mountains
The Caucasus Mountains is a mountain system in Eurasia between the Black Sea and the Caspian Sea in the Caucasus region .The Caucasus Mountains includes:* the Greater Caucasus Mountain Range and* the Lesser Caucasus Mountains....
represents a major exception where concentrations in the Kabardinian and Ossetian
Ossetian
Ossetian may refer to:* The Ossetian language* A member of the Ossetian people* A person from the region of Ossetia...
populations are noted. In Digora
Digora
Digora is a town and the administrative center of Digorsky District of the Republic of North Ossetia–Alania, Russia, located northwest of Vladikavkaz on the Ursdon River...
, North Ossetia the highest known concentration of G in a single town in the world is reached where 74% of the tested men were G. The Madyars of central Kazakhstan
Kazakhstan
Kazakhstan , officially the Republic of Kazakhstan, is a transcontinental country in Central Asia and Eastern Europe. Ranked as the ninth largest country in the world, it is also the world's largest landlocked country; its territory of is greater than Western Europe...
, a Kazakh sub-ethnic group, were found to be 87% G1. Haplogroup G is found as far east as northern China in small percentages where G can reach more substantial percentages in minority groups such as the Uyghurs.
In Turkey, the southern Caucasus region and Iran, haplogroup G reaches the highest percentage of a regional population worldwide. Among Turkish
Turkish people
Turkish people, also known as the "Turks" , are an ethnic group primarily living in Turkey and in the former lands of the Ottoman Empire where Turkish minorities had been established in Bulgaria, Cyprus, Bosnia and Herzegovina, Georgia, Greece, Kosovo, Macedonia, and Romania...
males 11% of the population is G. In Iran, Haplogroup G reaches 13 to 15% of the population in various parts of the country. While it is found in percentages higher than 10% among the Bakhtiari, Gilaki and Mazandarani
Mazandarani
Mazandarani may refer to :* Mazandarani people, Mazandaranis, Tabarian people* Mazandarani language, A language spoken mainly in South Caspian region* Morteza Sadouqi Mazandarani, Iranian grand ayatollah...
, it is closer to 5% among the Iranian Arabs and in some large cities. Among the samples in the YHRD database from the southern Caucasus countries, 29% of the samples from Abazinia
Abazinia
Abazinia, Abazashta or Abaza is a historical country at the northern mountainside of the Caucasus Major, now the northern part of Karachay-Cherkessian Republic, Russia. Abazinia is a home of the Abazins, a people related to the Abkhaz people and speaking the Abazin language.Abazinia once was a part...
, 31% from Georgia
Georgia (country)
Georgia is a sovereign state in the Caucasus region of Eurasia. Located at the crossroads of Western Asia and Eastern Europe, it is bounded to the west by the Black Sea, to the north by Russia, to the southwest by Turkey, to the south by Armenia, and to the southeast by Azerbaijan. The capital of...
, 18% from Azerbaijan
Azerbaijan
Azerbaijan , officially the Republic of Azerbaijan is the largest country in the Caucasus region of Eurasia. Located at the crossroads of Western Asia and Eastern Europe, it is bounded by the Caspian Sea to the east, Russia to the north, Georgia to the northwest, Armenia to the west, and Iran to...
and 11% from Armenia
Armenia
Armenia , officially the Republic of Armenia , is a landlocked mountainous country in the Caucasus region of Eurasia...
appear to be G samples.
In southern Asia, haplogroup G is found in concentrations of approximately 18% to 20% of Kalash
Kalash
Kalasha or Kalash may refer to:*Kalash people of Chitral, northern Pakistan**Kalasha **Kalash language, also known as Kalasha-mondr**Kalasha Desh, their valleys*Nuristani people of Nuristan, Afghanistan...
, approximately 16% of Brahui
Brahui people
The Brahui or Brohi are ethnic Baloch group of about 2.2 million people with the majority found in Kalat, Baluchistan, Pakistan, but they are also found in smaller numbers in neighboring Afghanistan and Iran. The Brahuis are almost entirely Sunni Muslims.-Origins:The ethnonym "Brahui" is a very...
, and approximately 11.5% of sampled Pashtun
Pashtun people
Pashtuns or Pathans , also known as ethnic Afghans , are an Eastern Iranic ethnic group with populations primarily between the Hindu Kush mountains in Afghanistan and the Indus River in Pakistan...
, but in only about 3% of the general Pakistan
Pakistan
Pakistan , officially the Islamic Republic of Pakistan is a sovereign state in South Asia. It has a coastline along the Arabian Sea and the Gulf of Oman in the south and is bordered by Afghanistan and Iran in the west, India in the east and China in the far northeast. In the north, Tajikistan...
i population. The many groups in India
India
India , officially the Republic of India , is a country in South Asia. It is the seventh-largest country by geographical area, the second-most populous country with over 1.2 billion people, and the most populous democracy in the world...
and Bangla Desh have not been well studied. About 6% of the samples from Sri Lanka
Sri Lanka
Sri Lanka, officially the Democratic Socialist Republic of Sri Lanka is a country off the southern coast of the Indian subcontinent. Known until 1972 as Ceylon , Sri Lanka is an island surrounded by the Indian Ocean, the Gulf of Mannar and the Palk Strait, and lies in the vicinity of India and the...
and Malaysia were reported as haplogroup G, but none were found in the other coastal lands of the Indian Ocean
Indian Ocean
The Indian Ocean is the third largest of the world's oceanic divisions, covering approximately 20% of the water on the Earth's surface. It is bounded on the north by the Indian Subcontinent and Arabian Peninsula ; on the west by eastern Africa; on the east by Indochina, the Sunda Islands, and...
or Pacific Ocean
Pacific Ocean
The Pacific Ocean is the largest of the Earth's oceanic divisions. It extends from the Arctic in the north to the Southern Ocean in the south, bounded by Asia and Australia in the west, and the Americas in the east.At 165.2 million square kilometres in area, this largest division of the World...
in Asia.
In the Middle East, haplogroup G accounts for about 3% of the population in almost all areas. Among the Druze
Druze
The Druze are an esoteric, monotheistic religious community, found primarily in Syria, Lebanon, Israel, and Jordan, which emerged during the 11th century from Ismailism. The Druze have an eclectic set of beliefs that incorporate several elements from Abrahamic religions, Gnosticism, Neoplatonism...
mostly residents of Israel
Israel
The State of Israel is a parliamentary republic located in the Middle East, along the eastern shore of the Mediterranean Sea...
10% were found to be haplogroup G.
In Africa, haplogroup G is rarely found in sub-Saharan Africa
Sub-Saharan Africa
Sub-Saharan Africa as a geographical term refers to the area of the African continent which lies south of the Sahara. A political definition of Sub-Saharan Africa, instead, covers all African countries which are fully or partially located south of the Sahara...
or south of the horn of Africa
Horn of Africa
The Horn of Africa is a peninsula in East Africa that juts hundreds of kilometers into the Arabian Sea and lies along the southern side of the Gulf of Aden. It is the easternmost projection of the African continent...
among native populations. In Egypt
Egypt
Egypt , officially the Arab Republic of Egypt, Arabic: , is a country mainly in North Africa, with the Sinai Peninsula forming a land bridge in Southwest Asia. Egypt is thus a transcontinental country, and a major power in Africa, the Mediterranean Basin, the Middle East and the Muslim world...
, studies have provided information that pegs the G percentage there to be between 2% and 9%. Three percent of North African Berbers
Berber people
Berbers are the indigenous peoples of North Africa west of the Nile Valley. They are continuously distributed from the Atlantic to the Siwa oasis, in Egypt, and from the Mediterranean to the Niger River. Historically they spoke the Berber language or varieties of it, which together form a branch...
were found to be haplogroup G. Two percent of Arab Moroccans and 8% of Berber Moroccans were likewise found to be G.
In the Americas, the percentage of haplogroup G corresponds to the numbers of persons from Old World countries who emigrated. It is not found among Native Americans
Indigenous peoples of the Americas
The indigenous peoples of the Americas are the pre-Columbian inhabitants of North and South America, their descendants and other ethnic groups who are identified with those peoples. Indigenous peoples are known in Canada as Aboriginal peoples, and in the United States as Native Americans...
except where intermarriage with non-native persons has occurred.
Around 10% of Jewish
Jews
The Jews , also known as the Jewish people, are a nation and ethnoreligious group originating in the Israelites or Hebrews of the Ancient Near East. The Jewish ethnicity, nationality, and religion are strongly interrelated, as Judaism is the traditional faith of the Jewish nation...
males are Haplogroup G.
Famous members
Joseph StalinJoseph Stalin
Joseph Vissarionovich Stalin was the Premier of the Soviet Union from 6 May 1941 to 5 March 1953. He was among the Bolshevik revolutionaries who brought about the October Revolution and had held the position of first General Secretary of the Communist Party of the Soviet Union's Central Committee...
, from a genetic test on his grandson (his son Vasily's son; Alexander Burdonsky), shows his Y-DNA haplogroup to be G2a1a http://www.runewsweek.ru/theme/?tid=96&rid=1567
| DYS | 393 | 390 | 19 | 391 | 385A | 385B | 426 | 388 | 439 | 389I | 392 | 389II | 458 | 459A | 459B | 455 | 454 | 447 | 437 | 448 | 449 | 464A | 464B | 464C | 464D |
| Alleles | 14 | 23 | 15 | 9 | 15 | 16 | 11 | 12 | 11 | 11 | 10 | 28 | 17 | 9 | 9 | 11 | 11 | 25 | 16 | 21 | 28 | 13 | 13 | 14 | 14 |
King Louis XVI of France
Louis XVI of France
Louis XVI was a Bourbon monarch who ruled as King of France and Navarre until 1791, and then as King of the French from 1791 to 1792, before being executed in 1793....
from a genetic test on blood in a cloth purported to have been collected at his beheading and maintained in an ornate gourd decorated with French Revolution
French Revolution
The French Revolution , sometimes distinguished as the 'Great French Revolution' , was a period of radical social and political upheaval in France and Europe. The absolute monarchy that had ruled France for centuries collapsed in three years...
themes. Confirmation of this genetic profile requires testing of a known relative. The sample was tested at two laboratories with the same results. The sample is most consistent with G2a3b1a samples and contains unusually high, rare values for markers DYS385B and DYS458 within this G subgroup.
| DYS | 393 | 390 | 19 | 391 | 385A | 385B | 439 | 389I | 392 | 389II | 448 | 458 | 456 | 437 | 438 | YGATAH4 | DYS635 |
| Alleles | 14 | 22 | 15 | 10 | 13 | 18 | 12 | 12 | 11 | 30 | 21 | 21 | 15 | 15 | 10 | 12 | 21 |
Other notables purported to belong to haplogroup G include American historical figures Phillip Hamman
Phillip Hamman
Phillip Hamman, Sr. , known as "The Savior of Greenbrier", was an American frontier hero who was commended for bravery in the defence of Fort Donnally of Greenbrier County, West Virginia from a Shawnee attack in 1778. Hamman and John Pryor volunteered to go to Greenbrier County and warn the people...
and Linn Banks
Linn Banks
Linn Banks was a nineteenth century politician and lawyer from Virginia. He was born in Culpeper County, Virginia to parents Adam Banks and Gracey James. He married on April 2, 1811 to Eliza Jane Hunter Sanders...
(U.S. Representative from Virginia),
physicist John G. Cramer
John G. Cramer
John G. Cramer is a professor of physics at the University of Washington in Seattle, the United States. When not teaching, he works with the STAR detector at the new Relativistic Heavy Ion Collider at Brookhaven National Laboratory, and the particle accelerator at CERN in Geneva, Switzerland...
, actor James Franciscus
James Franciscus
James Grover Franciscus was an American actor, known for his roles in the series The Naked City and The Investigators, and in feature films.-Life and career:...
, and former Chairman of the United States Federal Communications Commission
Federal Communications Commission
The Federal Communications Commission is an independent agency of the United States government, created, Congressional statute , and with the majority of its commissioners appointed by the current President. The FCC works towards six goals in the areas of broadband, competition, the spectrum, the...
(FCC) and Chairman of the Public Broadcasting Service
Public Broadcasting Service
The Public Broadcasting Service is an American non-profit public broadcasting television network with 354 member TV stations in the United States which hold collective ownership. Its headquarters is in Arlington, Virginia....
, Newton Minow.