.gif)
Haplogroup I (Y-DNA)
Encyclopedia
In human genetics
, Haplogroup I (the letter I, not the number 1) is a Y-chromosome DNA haplogroup, a subgroup of haplogroup IJ
, itself a derivative of Haplogroup IJK
.
Y-DNA Haplogroup I is predominantly a European haplogroup today. It represents nearly one-fifth of the population of Europe
. It can be found in the majority of present-day European populations. Haplogroup I Y-chromosomes have also been found among some populations of the Near East
, the Caucasus
, Northeast Africa and Central Siberia.
) for the I clade
was estimated by Karafet and colleagues in 2008 as 22.2 k.a. (22,200 years ago) with a confidence interval between 15.3-30.0 ka., placing the Haplogroup I founding event approximately contemporaneous with the Last Glacial Maximum
(LGM) which lasted from 26.5 ka to 19 or 20 ka.
The TMRCA is an estimate of the time of subclade divergence. Rootsi and colleagues in 2004 also note two other dates for a clade, age of STR variation, and time since population divergence. These last two dates are roughly associated, and occur somewhat after subclade divergence. For Haplogroup I they estimate time to STR variation as 24±7.1 ky and time to population divergence as 23±7.7 ky. These estimates are consistent with those of Karafet 2008 cited above. However Underhill and his colleagues calculate the time to subclade divergence of I1 and I2 to be 28.4±5.1 ky, though they calculate the STR variation age of I1 at only 8.1±1.5 kya.
Some speculate the initial dispersion of this population corresponds to the diffusion of the Gravettian
culture. Rootsi and colleagues in 2004 suggested that each of the ancestral populations now dominated by a particular subclade of Haplogroup I experienced an independent population expansion immediately after the last glacial maximum
.
65% (Bosnia 54%, Herzegovina
71%).
Other higher than average densities occur in the Caucasus
: Darginians of Dagestan
58% and Abkhazians 33%, Croatia
(mainland 38%, Hvar
66%, Korcula
54%), Serbia
(Serbs 48%), 23.6% of German
males carry the haplogroup I
mutation, (highest frequency in Northern Germany
37.5%), Norway
40%, Sardinia
37% (42%), Sweden
(North 26%, Gotland
& Värmland
50%), Denmark
39%, Montenegro
38%, Bosnian Serbs
41% (36%), Iran
: in Tehran
34%, though in Isfahan only 10%, Iceland
33%, and West Finland
41%, though the figure drops in East Finland to 20%
Average densities occur in Macedonia
34%, Bulgaria
28%, Albania
25%, Hungary
11% 28%, Netherlands
25%, England
20%, Romania
/Moldova
22%, though reaching 48% in Buhuşi
and Piatra Neamţ
.
Within Europe, several populations are distinguished by having a significantly lower frequency of Haplogroup I than the surrounding populations: Italy
and Switzerland
have lower levels than Germany
and Sardinia
, Iberia
has a lower density than southern France
and Normandy
, Greece
has a lower level than Albania
and the Slavic peoples
, while the Baltic
-speaking Latvians have a lower level than the Finnic
-speaking Estonian
s. In all these areas, Haplogroup I populations are small relative to the dominant haplogroups in Europe (R1b in Western Europe, R1a1 in Eastern Europe, and N in Northeastern Europe).
The subclade
s of Haplogroup I with their defining mutations:
Note that the naming of some of the subgroups has changed, as new markers have been identified, and the sequence of mutations has become clearer..
Several haplogroup I-M170 individuals who do not fall in known subclades, with some of the greatest Y-STR diversity, have significantly been found among the populations of Turkey
(8/741), Adygea (2/138), and Iraq
(1/176),even though as a whole Haplogroup I-M170 occurs at only very low frequencies among modern populations of the Middle East and Caucasus. This is consistent with the belief that the haplogroup first appeared in that region. Overall, the highest frequencies of Haplogroup I-M170 appear to be found among the Andalusians
(3/103), French
(4/179), Slovenians (2/55), Tabassarans (1/30) and the Saami (1/35). http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=1181996&rendertype=table&id=TB1 The greatest figure so far for I* was among the Laks in Dagestan, at a rate of (3/21), although only 21 Laks were tested.
, southwestern Sweden
, and Denmark
, and rapidly decreasing frequencies toward the edges of the historically Germanic
-influenced world. A notable exception is Finland
, where frequency in West Finns is up to 40%, and in certain provinces like Satakunta more than 50%.
Outside Fennoscandia
, distribution of Haplogroup I-M253 is closely correlated with that of Haplogroup I-M436; but among Scandinavians (including both Germanic and Uralic peoples of the region) nearly all the Haplogroup I Y-chromosomes are I-M253. Another characteristic of the Scandinavian I-M253 Y-chromosomes is their rather low haplotype
diversity (STR diversity): a greater variety of Haplogroup I-M253 Y-chromosomes has been found among the French
and Italians
, despite the much lower overall frequency of Haplogroup I-M253 among the modern French and Italian populations.
Haplogroup I-M423 is the most frequent Y-chromosome Haplogroup I in Central and Eastern European populations, reaching its peak in the Western Balkans, most notably in Dalmatia
(50-60%) and Bosnia-Herzegovina (up to 71%, avg. 40-50%). A greater variance of this group has been found in Ireland and Great Britain, but overall frequency is very low (2-3%). Haplogroup I-M423 is virtually absent in Fennoscandia
, Western and Southwestern Europe.
Haplogroup I-M26 is notable for its strong presence in Sardinia. Haplogroup I comprises approximately 40% of all patrilines among the Sardinians, and I-M26 is the predominant type of I among them.
Haplogroup I-M26 is practically absent east of France
and Italy
., while it is found at low but significant frequencies outside of Sardinia in the Balearic Islands
, Castile-Leon
, the Basque Country
, the Pyrenees
, southern and western France, and parts of the Maghreb
in North Africa
, Great Britain
, and Ireland
. Haplogroup I-M26 appears to be the only subclade of Haplogroup I found among the Basques
, but appears to be found at somewhat higher frequencies among the general populations of Castile-Leon
in Spain and Béarn
in France than among the population of ethnic Basques. The M26 mutation is found in native males inhabiting every geographic region where megaliths may be found, including such far-flung and culturally disconnected regions as the Canary Islands, the Balearic Isles, Corsica, Ireland, and Sweden.
The distribution of M26 also mirrors that of the Atlantic Bronze Age
cultures, which indicates a potential spread via the obsidian
trade or a regular maritime exchange of some of metallurgical products.
, which suggests that it was probably harbored by at least one of the Paleolithic refuge populations that also harbored Haplogroup I-M253; the lack of correlation between the distributions of I-M253 and I-M436 in Fennoscandia may be a result of Haplogroup I-M436's being more strongly affected in the earliest settlement of this region by founder effect
s and genetic drift
due to its rarity, as Haplogroup I-M436 comprises less than 10% of the total Y-chromosome diversity of all populations outside of Lower Saxony
. Haplogroup I-M436 has been found in over 4% of the population only in Germany
, the Netherlands
, Belgium
, Denmark
, England
(not including Cornwall
), Scotland
, and the southern tips of Sweden
and Norway
in Northwest Europe; the provinces of Normandy
, Maine
, Anjou
, and Perche
in northwestern France
; the province of Provence
in southeastern France; the regions of Tuscany
, Umbria
, and Latium
in Italy
; and Moldavia
and the area around Russia's Ryazan Oblast
and Republic of Mordovia
in Eastern Europe. One subclade of Haplogroup I-M436, namely I-M284, has been found almost exclusively among the population of Great Britain
, which has been taken to suggest that the clade may have a very long history in that island. It is notable, however, that the distributions of Haplogroup I-M253 and Haplogroup I-M436 seem to correlate fairly well with the extent of historical influence of Germanic peoples
, although the punctual presence of both haplogroups at a low frequency in the area of the historical regions of Bithynia
and Galatia
in Turkey
rather suggests a connection with the ancient Gauls
of Thrace
, several tribes of which are recorded to have immigrated to those parts of Anatolia at the invitation of Nicomedes I of Bithynia
. This suggestion is supported by recent genetic studies regarding Y-DNA Haplogroup I2b2-L38 have concluded that there was some Late Iron Age migration of Celtic La Tène people, through Belgium, to the British Isles including north-east Ireland.
Haplogroup I-M436 also occurs among approximately 1% of Sardinians.
Human genetics
Human genetics describes the study of inheritance as it occurs in human beings. Human genetics encompasses a variety of overlapping fields including: classical genetics, cytogenetics, molecular genetics, biochemical genetics, genomics, population genetics, developmental genetics, clinical genetics,...
, Haplogroup I (the letter I, not the number 1) is a Y-chromosome DNA haplogroup, a subgroup of haplogroup IJ
Haplogroup IJ (Y-DNA)
In human genetics, Haplogroup IJ is a human Y-chromosome DNA haplogroup.Haplogroup IJ is a descendant branch of Haplogroup IJK which in turn derives from the greater Haplogroup F. Descendants are Haplogroup I and Haplogroup J...
, itself a derivative of Haplogroup IJK
Haplogroup IJK (Y-DNA)
In human genetics, Haplogroup IJK is a human Y-chromosome DNA haplogroup.Haplogroup IJK is a descendant branch of the macrohaplogroup F with haplogroup IJ and haplogroup K as its attested descendants....
.
Y-DNA Haplogroup I is predominantly a European haplogroup today. It represents nearly one-fifth of the population of Europe
Europe
Europe is, by convention, one of the world's seven continents. Comprising the westernmost peninsula of Eurasia, Europe is generally 'divided' from Asia to its east by the watershed divides of the Ural and Caucasus Mountains, the Ural River, the Caspian and Black Seas, and the waterways connecting...
. It can be found in the majority of present-day European populations. Haplogroup I Y-chromosomes have also been found among some populations of the Near East
Near East
The Near East is a geographical term that covers different countries for geographers, archeologists, and historians, on the one hand, and for political scientists, economists, and journalists, on the other...
, the Caucasus
Caucasus
The Caucasus, also Caucas or Caucasia , is a geopolitical region at the border of Europe and Asia, and situated between the Black and the Caspian sea...
, Northeast Africa and Central Siberia.
Origins
The TMRCA (time to most recent common ancestorMost recent common ancestor
In genetics, the most recent common ancestor of any set of organisms is the most recent individual from which all organisms in the group are directly descended...
) for the I clade
Clade
A clade is a group consisting of a species and all its descendants. In the terms of biological systematics, a clade is a single "branch" on the "tree of life". The idea that such a "natural group" of organisms should be grouped together and given a taxonomic name is central to biological...
was estimated by Karafet and colleagues in 2008 as 22.2 k.a. (22,200 years ago) with a confidence interval between 15.3-30.0 ka., placing the Haplogroup I founding event approximately contemporaneous with the Last Glacial Maximum
Last Glacial Maximum
The Last Glacial Maximum refers to a period in the Earth's climate history when ice sheets were at their maximum extension, between 26,500 and 19,000–20,000 years ago, marking the peak of the last glacial period. During this time, vast ice sheets covered much of North America, northern Europe and...
(LGM) which lasted from 26.5 ka to 19 or 20 ka.
The TMRCA is an estimate of the time of subclade divergence. Rootsi and colleagues in 2004 also note two other dates for a clade, age of STR variation, and time since population divergence. These last two dates are roughly associated, and occur somewhat after subclade divergence. For Haplogroup I they estimate time to STR variation as 24±7.1 ky and time to population divergence as 23±7.7 ky. These estimates are consistent with those of Karafet 2008 cited above. However Underhill and his colleagues calculate the time to subclade divergence of I1 and I2 to be 28.4±5.1 ky, though they calculate the STR variation age of I1 at only 8.1±1.5 kya.
Some speculate the initial dispersion of this population corresponds to the diffusion of the Gravettian
Gravettian
thumb|right|Burins to the Gravettian culture.The Gravettian toolmaking culture was a specific archaeological industry of the European Upper Palaeolithic era prevalent before the last glacial epoch. It is named after the type site of La Gravette in the Dordogne region of France where its...
culture. Rootsi and colleagues in 2004 suggested that each of the ancestral populations now dominated by a particular subclade of Haplogroup I experienced an independent population expansion immediately after the last glacial maximum
Last Glacial Maximum
The Last Glacial Maximum refers to a period in the Earth's climate history when ice sheets were at their maximum extension, between 26,500 and 19,000–20,000 years ago, marking the peak of the last glacial period. During this time, vast ice sheets covered much of North America, northern Europe and...
.
Distribution
The following figures include all subclades. The greatest density of Haplogoup I is to be found in Bosnia and HerzegovinaBosnia and Herzegovina
Bosnia and Herzegovina , sometimes called Bosnia-Herzegovina or simply Bosnia, is a country in Southern Europe, on the Balkan Peninsula. Bordered by Croatia to the north, west and south, Serbia to the east, and Montenegro to the southeast, Bosnia and Herzegovina is almost landlocked, except for the...
65% (Bosnia 54%, Herzegovina
Herzegovina
Herzegovina is the southern region of Bosnia and Herzegovina. While there is no official border distinguishing it from the Bosnian region, it is generally accepted that the borders of the region are Croatia to the west, Montenegro to the south, the canton boundaries of the Herzegovina-Neretva...
71%).
Other higher than average densities occur in the Caucasus
Caucasus
The Caucasus, also Caucas or Caucasia , is a geopolitical region at the border of Europe and Asia, and situated between the Black and the Caspian sea...
: Darginians of Dagestan
Dagestan
The Republic of Dagestan is a federal subject of Russia, located in the North Caucasus region. Its capital and the largest city is Makhachkala, located at the center of Dagestan on the Caspian Sea...
58% and Abkhazians 33%, Croatia
Croatia
Croatia , officially the Republic of Croatia , is a unitary democratic parliamentary republic in Europe at the crossroads of the Mitteleuropa, the Balkans, and the Mediterranean. Its capital and largest city is Zagreb. The country is divided into 20 counties and the city of Zagreb. Croatia covers ...
(mainland 38%, Hvar
Hvar
- Climate :The climate of Hvar is characterized by mild winters and warm summers. The yearly average air temperature is , 686 mm of precipitation fall on the town of Hvar on average every year and the town has a total of 2800 sunshine hours per year. For comparison Hvar has an average of 7.7...
66%, Korcula
Korcula
Korčula is an island in the Adriatic Sea, in the Dubrovnik-Neretva County of Croatia. The island has an area of ; long and on average wide — and lies just off the Dalmatian coast. Its 16,182 inhabitants make it the second most populous Adriatic island after Krk...
54%), Serbia
Serbia
Serbia , officially the Republic of Serbia , is a landlocked country located at the crossroads of Central and Southeast Europe, covering the southern part of the Carpathian basin and the central part of the Balkans...
(Serbs 48%), 23.6% of German
Germans
The Germans are a Germanic ethnic group native to Central Europe. The English term Germans has referred to the German-speaking population of the Holy Roman Empire since the Late Middle Ages....
males carry the haplogroup I
Haplogroup I
Haplogroup I may refer to:* Haplogroup I , a human mitochondrial DNA haplogroup* Haplogroup I , a human Y-chromosome haplogroup...
mutation, (highest frequency in Northern Germany
Northern Germany
- Geography :The key terrain features of North Germany are the marshes along the coastline of the North Sea and Baltic Sea, and the geest and heaths inland. Also prominent are the low hills of the Baltic Uplands, the ground moraines, end moraines, sandur, glacial valleys, bogs, and Luch...
37.5%), Norway
Norway
Norway , officially the Kingdom of Norway, is a Nordic unitary constitutional monarchy whose territory comprises the western portion of the Scandinavian Peninsula, Jan Mayen, and the Arctic archipelago of Svalbard and Bouvet Island. Norway has a total area of and a population of about 4.9 million...
40%, Sardinia
Sardinia
Sardinia is the second-largest island in the Mediterranean Sea . It is an autonomous region of Italy, and the nearest land masses are the French island of Corsica, the Italian Peninsula, Sicily, Tunisia and the Spanish Balearic Islands.The name Sardinia is from the pre-Roman noun *sard[],...
37% (42%), Sweden
Sweden
Sweden , officially the Kingdom of Sweden , is a Nordic country on the Scandinavian Peninsula in Northern Europe. Sweden borders with Norway and Finland and is connected to Denmark by a bridge-tunnel across the Öresund....
(North 26%, Gotland
Gotland
Gotland is a county, province, municipality and diocese of Sweden; it is Sweden's largest island and the largest island in the Baltic Sea. At 3,140 square kilometers in area, the region makes up less than one percent of Sweden's total land area...
& Värmland
Värmland
' is a historical province or landskap in the west of middle Sweden. It borders Västergötland, Dalsland, Dalarna, Västmanland and Närke. It is also bounded by Norway in the west. Latin name versions are Vermelandia and Wermelandia. Although the province's land originally was Götaland, the...
50%), Denmark
Denmark
Denmark is a Scandinavian country in Northern Europe. The countries of Denmark and Greenland, as well as the Faroe Islands, constitute the Kingdom of Denmark . It is the southernmost of the Nordic countries, southwest of Sweden and south of Norway, and bordered to the south by Germany. Denmark...
39%, Montenegro
Montenegro
Montenegro Montenegrin: Crna Gora Црна Гора , meaning "Black Mountain") is a country located in Southeastern Europe. It has a coast on the Adriatic Sea to the south-west and is bordered by Croatia to the west, Bosnia and Herzegovina to the northwest, Serbia to the northeast and Albania to the...
38%, Bosnian Serbs
Serbs of Bosnia and Herzegovina
The Serbs of Bosnia and Herzegovina are people of Serb ethnicity inhabiting the Balkan regions of Bosnia and Herzegovina, or, since the establishment of Bosnia and Herzegovina as a state in the 1990s, the Serbs who have its citizenship. The Serbs are one of the three constitutive nations of this...
41% (36%), Iran
Iran
Iran , officially the Islamic Republic of Iran , is a country in Southern and Western Asia. The name "Iran" has been in use natively since the Sassanian era and came into use internationally in 1935, before which the country was known to the Western world as Persia...
: in Tehran
Tehran
Tehran , sometimes spelled Teheran, is the capital of Iran and Tehran Province. With an estimated population of 8,429,807; it is also Iran's largest urban area and city, one of the largest cities in Western Asia, and is the world's 19th largest city.In the 20th century, Tehran was subject to...
34%, though in Isfahan only 10%, Iceland
Iceland
Iceland , described as the Republic of Iceland, is a Nordic and European island country in the North Atlantic Ocean, on the Mid-Atlantic Ridge. Iceland also refers to the main island of the country, which contains almost all the population and almost all the land area. The country has a population...
33%, and West Finland
Finland
Finland , officially the Republic of Finland, is a Nordic country situated in the Fennoscandian region of Northern Europe. It is bordered by Sweden in the west, Norway in the north and Russia in the east, while Estonia lies to its south across the Gulf of Finland.Around 5.4 million people reside...
41%, though the figure drops in East Finland to 20%
Average densities occur in Macedonia
Republic of Macedonia
Macedonia , officially the Republic of Macedonia , is a country located in the central Balkan peninsula in Southeast Europe. It is one of the successor states of the former Yugoslavia, from which it declared independence in 1991...
34%, Bulgaria
Bulgaria
Bulgaria , officially the Republic of Bulgaria , is a parliamentary democracy within a unitary constitutional republic in Southeast Europe. The country borders Romania to the north, Serbia and Macedonia to the west, Greece and Turkey to the south, as well as the Black Sea to the east...
28%, Albania
Albania
Albania , officially known as the Republic of Albania , is a country in Southeastern Europe, in the Balkans region. It is bordered by Montenegro to the northwest, Kosovo to the northeast, the Republic of Macedonia to the east and Greece to the south and southeast. It has a coast on the Adriatic Sea...
25%, Hungary
Hungary
Hungary , officially the Republic of Hungary , is a landlocked country in Central Europe. It is situated in the Carpathian Basin and is bordered by Slovakia to the north, Ukraine and Romania to the east, Serbia and Croatia to the south, Slovenia to the southwest and Austria to the west. The...
11% 28%, Netherlands
Netherlands
The Netherlands is a constituent country of the Kingdom of the Netherlands, located mainly in North-West Europe and with several islands in the Caribbean. Mainland Netherlands borders the North Sea to the north and west, Belgium to the south, and Germany to the east, and shares maritime borders...
25%, England
England
England is a country that is part of the United Kingdom. It shares land borders with Scotland to the north and Wales to the west; the Irish Sea is to the north west, the Celtic Sea to the south west, with the North Sea to the east and the English Channel to the south separating it from continental...
20%, Romania
Romania
Romania is a country located at the crossroads of Central and Southeastern Europe, on the Lower Danube, within and outside the Carpathian arch, bordering on the Black Sea...
/Moldova
Moldova
Moldova , officially the Republic of Moldova is a landlocked state in Eastern Europe, located between Romania to the West and Ukraine to the North, East and South. It declared itself an independent state with the same boundaries as the preceding Moldavian Soviet Socialist Republic in 1991, as part...
22%, though reaching 48% in Buhuşi
Buhusi
Buhuşi is a town in Bacău County, Romania with a population of about 18,980. It was first mentioned in the 15th century when it was named "Bodeşti" and was a property of an important family of Boyars named "Buhuş". Lucian Predescu Buhuşi is a town in Bacău County, Romania with a population of...
and Piatra Neamţ
Piatra Neamt
Piatra Neamț , , ; is the capital city of Neamţ County, in the historical region of Moldavia, eastern Romania. Because of its privileged location in the Eastern Carpathian mountains, it is considered one of the most picturesque cities in Romania...
.
Within Europe, several populations are distinguished by having a significantly lower frequency of Haplogroup I than the surrounding populations: Italy
Italy
Italy , officially the Italian Republic languages]] under the European Charter for Regional or Minority Languages. In each of these, Italy's official name is as follows:;;;;;;;;), is a unitary parliamentary republic in South-Central Europe. To the north it borders France, Switzerland, Austria and...
and Switzerland
Switzerland
Switzerland name of one of the Swiss cantons. ; ; ; or ), in its full name the Swiss Confederation , is a federal republic consisting of 26 cantons, with Bern as the seat of the federal authorities. The country is situated in Western Europe,Or Central Europe depending on the definition....
have lower levels than Germany
Germany
Germany , officially the Federal Republic of Germany , is a federal parliamentary republic in Europe. The country consists of 16 states while the capital and largest city is Berlin. Germany covers an area of 357,021 km2 and has a largely temperate seasonal climate...
and Sardinia
Sardinia
Sardinia is the second-largest island in the Mediterranean Sea . It is an autonomous region of Italy, and the nearest land masses are the French island of Corsica, the Italian Peninsula, Sicily, Tunisia and the Spanish Balearic Islands.The name Sardinia is from the pre-Roman noun *sard[],...
, Iberia
Iberian Peninsula
The Iberian Peninsula , sometimes called Iberia, is located in the extreme southwest of Europe and includes the modern-day sovereign states of Spain, Portugal and Andorra, as well as the British Overseas Territory of Gibraltar...
has a lower density than southern France
France
The French Republic , The French Republic , The French Republic , (commonly known as France , is a unitary semi-presidential republic in Western Europe with several overseas territories and islands located on other continents and in the Indian, Pacific, and Atlantic oceans. Metropolitan France...
and Normandy
Normandy
Normandy is a geographical region corresponding to the former Duchy of Normandy. It is in France.The continental territory covers 30,627 km² and forms the preponderant part of Normandy and roughly 5% of the territory of France. It is divided for administrative purposes into two régions:...
, Greece
Greece
Greece , officially the Hellenic Republic , and historically Hellas or the Republic of Greece in English, is a country in southeastern Europe....
has a lower level than Albania
Albania
Albania , officially known as the Republic of Albania , is a country in Southeastern Europe, in the Balkans region. It is bordered by Montenegro to the northwest, Kosovo to the northeast, the Republic of Macedonia to the east and Greece to the south and southeast. It has a coast on the Adriatic Sea...
and the Slavic peoples
Slavic peoples
The Slavic people are an Indo-European panethnicity living in Eastern Europe, Southeast Europe, North Asia and Central Asia. The term Slavic represents a broad ethno-linguistic group of people, who speak languages belonging to the Slavic language family and share, to varying degrees, certain...
, while the Baltic
Baltic languages
The Baltic languages are a group of related languages belonging to the Balto-Slavic branch of the Indo-European language family and spoken mainly in areas extending east and southeast of the Baltic Sea in Northern Europe...
-speaking Latvians have a lower level than the Finnic
Finnic peoples
The Finnic or Fennic peoples were historic ethnic groups who spoke various languages traditionally classified as Finno-Permic...
-speaking Estonian
Estonian language
Estonian is the official language of Estonia, spoken by about 1.1 million people in Estonia and tens of thousands in various émigré communities...
s. In all these areas, Haplogroup I populations are small relative to the dominant haplogroups in Europe (R1b in Western Europe, R1a1 in Eastern Europe, and N in Northeastern Europe).
Subgroups
The subclade
Subclade
In genetics, subclade is a term used to describe a subgroup of a subgenus or haplogroup. It is commonly used today in describing genealogical DNA tests of human mitochondrial DNA haplogroups and human Y-chromosome DNA haplogroups....
s of Haplogroup I with their defining mutations:
- I-M170 ( L41, M170, M258, P19_1, P19_2, P19_3, P19_4, P19_5, P38, P212, Page123, U179)
- I* Unobserved in EuropeEuropeEurope is, by convention, one of the world's seven continents. Comprising the westernmost peninsula of Eurasia, Europe is generally 'divided' from Asia to its east by the watershed divides of the Ural and Caucasus Mountains, the Ural River, the Caspian and Black Seas, and the waterways connecting...
, Middle East and Caucasus. - I1-M253Haplogroup I1 (Y-DNA)In human genetics, Haplogroup I1 is a Y chromosome haplogroup occurring at greatest frequency in Scandinavia, associated with the mutations identified as M253, M307, P30, and P40. These are known as single nucleotide polymorphisms . It is a subclade of Haplogroup I. Before a reclassification in...
(L64, L75, L80, L81, L118, L121/S62, L123, L124/S64, L125/S65, L157, L186, L187, M253,M307.2/P203.2, M450/S109, P30, P40, S63, S66, S107, S108, S110, S111) Typical of populations of ScandinaviaScandinaviaScandinavia is a cultural, historical and ethno-linguistic region in northern Europe that includes the three kingdoms of Denmark, Norway and Sweden, characterized by their common ethno-cultural heritage and language. Modern Norway and Sweden proper are situated on the Scandinavian Peninsula,...
and Northwest Europe, with a moderate distribution throughout Eastern EuropeEastern EuropeEastern Europe is the eastern part of Europe. The term has widely disparate geopolitical, geographical, cultural and socioeconomic readings, which makes it highly context-dependent and even volatile, and there are "almost as many definitions of Eastern Europe as there are scholars of the region"...
- I1* In AnatoliaAnatoliaAnatolia is a geographic and historical term denoting the westernmost protrusion of Asia, comprising the majority of the Republic of Turkey...
at 1% - I1a-M21 (M21)
- I1b-M227 (M227) Appears to be limited to a marginally low frequency of approximately 1% among SlavicSlavic peoplesThe Slavic people are an Indo-European panethnicity living in Eastern Europe, Southeast Europe, North Asia and Central Asia. The term Slavic represents a broad ethno-linguistic group of people, who speak languages belonging to the Slavic language family and share, to varying degrees, certain...
and Uralic peoples of Eastern EuropeEastern EuropeEastern Europe is the eastern part of Europe. The term has widely disparate geopolitical, geographical, cultural and socioeconomic readings, which makes it highly context-dependent and even volatile, and there are "almost as many definitions of Eastern Europe as there are scholars of the region"...
; also detected in a single LebaneseLebanonLebanon , officially the Republic of LebanonRepublic of Lebanon is the most common term used by Lebanese government agencies. The term Lebanese Republic, a literal translation of the official Arabic and French names that is not used in today's world. Arabic is the most common language spoken among...
man- I1b1-M72 (M72)
- I1c-P259 (P259/M507)
- I1d-L22 (L22/S142)
- I1d*
- I1d1-P109 (P109)
- I1d2-L205 (L205)
- I1d3-L287 (L287)
- I1d3*
- I1d3a (L258)
- I1e (I211)
- I1f (L338)
- I1* In Anatolia
- I2-M438 (L68, M438/P215/S31). For details om subclades see Haplogroup I2Haplogroup I2 (Y-DNA)In human genetics, Haplogroup I2 is a Y-chromosome haplogroup. Until 2008, it was known as Haplogroup I1b. Haplogroup I2 might have originated in Southeastern Europe some 15,000 - 17,000 years ago and developed into three main subgroups : I2*, I2a, and I2b.-Subclades:Note: The systematic subclade...
- I* Unobserved in Europe
Note that the naming of some of the subgroups has changed, as new markers have been identified, and the sequence of mutations has become clearer..
I*-M170
The composite subclade I contains individuals directly descended from the earliest members of Haplogroup I, bearing none of the subsequent mutations which identify the remaining named subclades.Several haplogroup I-M170 individuals who do not fall in known subclades, with some of the greatest Y-STR diversity, have significantly been found among the populations of Turkey
Turkey
Turkey , known officially as the Republic of Turkey , is a Eurasian country located in Western Asia and in East Thrace in Southeastern Europe...
(8/741), Adygea (2/138), and Iraq
Iraq
Iraq ; officially the Republic of Iraq is a country in Western Asia spanning most of the northwestern end of the Zagros mountain range, the eastern part of the Syrian Desert and the northern part of the Arabian Desert....
(1/176),even though as a whole Haplogroup I-M170 occurs at only very low frequencies among modern populations of the Middle East and Caucasus. This is consistent with the belief that the haplogroup first appeared in that region. Overall, the highest frequencies of Haplogroup I-M170 appear to be found among the Andalusians
Andalusian people
The Andalusians are the people of the southern region in Spain approximated by what is now called Andalusia. They are generally not considered an ethnically distinct people because they lack two of the most important markers of distinctiveness: their own language and an awareness of a presumed...
(3/103), French
French people
The French are a nation that share a common French culture and speak the French language as a mother tongue. Historically, the French population are descended from peoples of Celtic, Latin and Germanic origin, and are today a mixture of several ethnic groups...
(4/179), Slovenians (2/55), Tabassarans (1/30) and the Saami (1/35). http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=1181996&rendertype=table&id=TB1 The greatest figure so far for I* was among the Laks in Dagestan, at a rate of (3/21), although only 21 Laks were tested.
I-M253
Haplogroup I-M253 (M253, M307, P30, P40) displays a very clear frequency gradient, with a peak frequency of approximately 35% among the populations of southern NorwayNorway
Norway , officially the Kingdom of Norway, is a Nordic unitary constitutional monarchy whose territory comprises the western portion of the Scandinavian Peninsula, Jan Mayen, and the Arctic archipelago of Svalbard and Bouvet Island. Norway has a total area of and a population of about 4.9 million...
, southwestern Sweden
Sweden
Sweden , officially the Kingdom of Sweden , is a Nordic country on the Scandinavian Peninsula in Northern Europe. Sweden borders with Norway and Finland and is connected to Denmark by a bridge-tunnel across the Öresund....
, and Denmark
Denmark
Denmark is a Scandinavian country in Northern Europe. The countries of Denmark and Greenland, as well as the Faroe Islands, constitute the Kingdom of Denmark . It is the southernmost of the Nordic countries, southwest of Sweden and south of Norway, and bordered to the south by Germany. Denmark...
, and rapidly decreasing frequencies toward the edges of the historically Germanic
Germanic peoples
The Germanic peoples are an Indo-European ethno-linguistic group of Northern European origin, identified by their use of the Indo-European Germanic languages which diversified out of Proto-Germanic during the Pre-Roman Iron Age.Originating about 1800 BCE from the Corded Ware Culture on the North...
-influenced world. A notable exception is Finland
Finland
Finland , officially the Republic of Finland, is a Nordic country situated in the Fennoscandian region of Northern Europe. It is bordered by Sweden in the west, Norway in the north and Russia in the east, while Estonia lies to its south across the Gulf of Finland.Around 5.4 million people reside...
, where frequency in West Finns is up to 40%, and in certain provinces like Satakunta more than 50%.
Outside Fennoscandia
Fennoscandia
Fennoscandia and Fenno-Scandinavia are geographic and geological terms used to describe the Scandinavian Peninsula, the Kola Peninsula, Karelia and Finland...
, distribution of Haplogroup I-M253 is closely correlated with that of Haplogroup I-M436; but among Scandinavians (including both Germanic and Uralic peoples of the region) nearly all the Haplogroup I Y-chromosomes are I-M253. Another characteristic of the Scandinavian I-M253 Y-chromosomes is their rather low haplotype
Haplotype
A haplotype in genetics is a combination of alleles at adjacent locations on the chromosome that are transmitted together...
diversity (STR diversity): a greater variety of Haplogroup I-M253 Y-chromosomes has been found among the French
French people
The French are a nation that share a common French culture and speak the French language as a mother tongue. Historically, the French population are descended from peoples of Celtic, Latin and Germanic origin, and are today a mixture of several ethnic groups...
and Italians
Italian people
The Italian people are an ethnic group that share a common Italian culture, ancestry and speak the Italian language as a mother tongue. Within Italy, Italians are defined by citizenship, regardless of ancestry or country of residence , and are distinguished from people...
, despite the much lower overall frequency of Haplogroup I-M253 among the modern French and Italian populations.
I-M438
I-M423
Haplogroup I-M423 is the most frequent Y-chromosome Haplogroup I in Central and Eastern European populations, reaching its peak in the Western Balkans, most notably in Dalmatia
Dalmatia
Dalmatia is a historical region on the eastern coast of the Adriatic Sea. It stretches from the island of Rab in the northwest to the Bay of Kotor in the southeast. The hinterland, the Dalmatian Zagora, ranges from fifty kilometers in width in the north to just a few kilometers in the south....
(50-60%) and Bosnia-Herzegovina (up to 71%, avg. 40-50%). A greater variance of this group has been found in Ireland and Great Britain, but overall frequency is very low (2-3%). Haplogroup I-M423 is virtually absent in Fennoscandia
Fennoscandia
Fennoscandia and Fenno-Scandinavia are geographic and geological terms used to describe the Scandinavian Peninsula, the Kola Peninsula, Karelia and Finland...
, Western and Southwestern Europe.
I-M26
Haplogroup I-M26 is notable for its strong presence in Sardinia. Haplogroup I comprises approximately 40% of all patrilines among the Sardinians, and I-M26 is the predominant type of I among them.
Haplogroup I-M26 is practically absent east of France
France
The French Republic , The French Republic , The French Republic , (commonly known as France , is a unitary semi-presidential republic in Western Europe with several overseas territories and islands located on other continents and in the Indian, Pacific, and Atlantic oceans. Metropolitan France...
and Italy
Italy
Italy , officially the Italian Republic languages]] under the European Charter for Regional or Minority Languages. In each of these, Italy's official name is as follows:;;;;;;;;), is a unitary parliamentary republic in South-Central Europe. To the north it borders France, Switzerland, Austria and...
., while it is found at low but significant frequencies outside of Sardinia in the Balearic Islands
Balearic Islands
The Balearic Islands are an archipelago of Spain in the western Mediterranean Sea, near the eastern coast of the Iberian Peninsula.The four largest islands are: Majorca, Minorca, Ibiza and Formentera. The archipelago forms an autonomous community and a province of Spain with Palma as the capital...
, Castile-Leon
Castile (historical region)
A former kingdom, Castile gradually merged with its neighbours to become the Crown of Castile and later the Kingdom of Spain when united with the Crown of Aragon and the Kingdom of Navarre...
, the Basque Country
Basque Country (historical territory)
The Basque Country is the name given to the home of the Basque people in the western Pyrenees that spans the border between France and Spain on the Atlantic coast....
, the Pyrenees
Pyrenees
The Pyrenees is a range of mountains in southwest Europe that forms a natural border between France and Spain...
, southern and western France, and parts of the Maghreb
Maghreb
The Maghreb is the region of Northwest Africa, west of Egypt. It includes five countries: Morocco, Algeria, Tunisia, Libya, and Mauritania and the disputed territory of Western Sahara...
in North Africa
North Africa
North Africa or Northern Africa is the northernmost region of the African continent, linked by the Sahara to Sub-Saharan Africa. Geopolitically, the United Nations definition of Northern Africa includes eight countries or territories; Algeria, Egypt, Libya, Morocco, South Sudan, Sudan, Tunisia, and...
, Great Britain
Great Britain
Great Britain or Britain is an island situated to the northwest of Continental Europe. It is the ninth largest island in the world, and the largest European island, as well as the largest of the British Isles...
, and Ireland
Ireland
Ireland is an island to the northwest of continental Europe. It is the third-largest island in Europe and the twentieth-largest island on Earth...
. Haplogroup I-M26 appears to be the only subclade of Haplogroup I found among the Basques
Basque people
The Basques as an ethnic group, primarily inhabit an area traditionally known as the Basque Country , a region that is located around the western end of the Pyrenees on the coast of the Bay of Biscay and straddles parts of north-central Spain and south-western France.The Basques are known in the...
, but appears to be found at somewhat higher frequencies among the general populations of Castile-Leon
Castile (historical region)
A former kingdom, Castile gradually merged with its neighbours to become the Crown of Castile and later the Kingdom of Spain when united with the Crown of Aragon and the Kingdom of Navarre...
in Spain and Béarn
Béarn
Béarn is one of the traditional provinces of France, located in the Pyrenees mountains and in the plain at their feet, in southwest France. Along with the three Basque provinces of Soule, Lower Navarre, and Labourd, the principality of Bidache, as well as small parts of Gascony, it forms in the...
in France than among the population of ethnic Basques. The M26 mutation is found in native males inhabiting every geographic region where megaliths may be found, including such far-flung and culturally disconnected regions as the Canary Islands, the Balearic Isles, Corsica, Ireland, and Sweden.
The distribution of M26 also mirrors that of the Atlantic Bronze Age
Atlantic Bronze Age
The Atlantic Bronze Age is a cultural complex of the Bronze Age period of approximately 1300–700 BC that includes different cultures in Portugal, Andalusia, Galicia, Armorica and the British Isles.-Trade:...
cultures, which indicates a potential spread via the obsidian
Obsidian
Obsidian is a naturally occurring volcanic glass formed as an extrusive igneous rock.It is produced when felsic lava extruded from a volcano cools rapidly with minimum crystal growth...
trade or a regular maritime exchange of some of metallurgical products.
I-M436
The distribution of Haplogroup I-M436 (M436/P214/S33, P216/S30, P217/S23, P218/S32) is closely correlated to that of Haplogroup I1 except in FennoscandiaFennoscandia
Fennoscandia and Fenno-Scandinavia are geographic and geological terms used to describe the Scandinavian Peninsula, the Kola Peninsula, Karelia and Finland...
, which suggests that it was probably harbored by at least one of the Paleolithic refuge populations that also harbored Haplogroup I-M253; the lack of correlation between the distributions of I-M253 and I-M436 in Fennoscandia may be a result of Haplogroup I-M436's being more strongly affected in the earliest settlement of this region by founder effect
Founder effect
In population genetics, the founder effect is the loss of genetic variation that occurs when a new population is established by a very small number of individuals from a larger population. It was first fully outlined by Ernst Mayr in 1942, using existing theoretical work by those such as Sewall...
s and genetic drift
Genetic drift
Genetic drift or allelic drift is the change in the frequency of a gene variant in a population due to random sampling.The alleles in the offspring are a sample of those in the parents, and chance has a role in determining whether a given individual survives and reproduces...
due to its rarity, as Haplogroup I-M436 comprises less than 10% of the total Y-chromosome diversity of all populations outside of Lower Saxony
Lower Saxony
Lower Saxony is a German state situated in north-western Germany and is second in area and fourth in population among the sixteen states of Germany...
. Haplogroup I-M436 has been found in over 4% of the population only in Germany
Germany
Germany , officially the Federal Republic of Germany , is a federal parliamentary republic in Europe. The country consists of 16 states while the capital and largest city is Berlin. Germany covers an area of 357,021 km2 and has a largely temperate seasonal climate...
, the Netherlands
Netherlands
The Netherlands is a constituent country of the Kingdom of the Netherlands, located mainly in North-West Europe and with several islands in the Caribbean. Mainland Netherlands borders the North Sea to the north and west, Belgium to the south, and Germany to the east, and shares maritime borders...
, Belgium
Belgium
Belgium , officially the Kingdom of Belgium, is a federal state in Western Europe. It is a founding member of the European Union and hosts the EU's headquarters, and those of several other major international organisations such as NATO.Belgium is also a member of, or affiliated to, many...
, Denmark
Denmark
Denmark is a Scandinavian country in Northern Europe. The countries of Denmark and Greenland, as well as the Faroe Islands, constitute the Kingdom of Denmark . It is the southernmost of the Nordic countries, southwest of Sweden and south of Norway, and bordered to the south by Germany. Denmark...
, England
England
England is a country that is part of the United Kingdom. It shares land borders with Scotland to the north and Wales to the west; the Irish Sea is to the north west, the Celtic Sea to the south west, with the North Sea to the east and the English Channel to the south separating it from continental...
(not including Cornwall
Cornwall
Cornwall is a unitary authority and ceremonial county of England, within the United Kingdom. It is bordered to the north and west by the Celtic Sea, to the south by the English Channel, and to the east by the county of Devon, over the River Tamar. Cornwall has a population of , and covers an area of...
), Scotland
Scotland
Scotland is a country that is part of the United Kingdom. Occupying the northern third of the island of Great Britain, it shares a border with England to the south and is bounded by the North Sea to the east, the Atlantic Ocean to the north and west, and the North Channel and Irish Sea to the...
, and the southern tips of Sweden
Sweden
Sweden , officially the Kingdom of Sweden , is a Nordic country on the Scandinavian Peninsula in Northern Europe. Sweden borders with Norway and Finland and is connected to Denmark by a bridge-tunnel across the Öresund....
and Norway
Norway
Norway , officially the Kingdom of Norway, is a Nordic unitary constitutional monarchy whose territory comprises the western portion of the Scandinavian Peninsula, Jan Mayen, and the Arctic archipelago of Svalbard and Bouvet Island. Norway has a total area of and a population of about 4.9 million...
in Northwest Europe; the provinces of Normandy
Normandy
Normandy is a geographical region corresponding to the former Duchy of Normandy. It is in France.The continental territory covers 30,627 km² and forms the preponderant part of Normandy and roughly 5% of the territory of France. It is divided for administrative purposes into two régions:...
, Maine
Maine
Maine is a state in the New England region of the northeastern United States, bordered by the Atlantic Ocean to the east and south, New Hampshire to the west, and the Canadian provinces of Quebec to the northwest and New Brunswick to the northeast. Maine is both the northernmost and easternmost...
, Anjou
Anjou
Anjou is a former county , duchy and province centred on the city of Angers in the lower Loire Valley of western France. It corresponds largely to the present-day département of Maine-et-Loire...
, and Perche
Perche
Perche is a former province of northern France extending over the départements of Orne, Eure, Eure-et-Loir and Sarthe, which were created from Perche during the French Revolution.-Geography:...
in northwestern France
France
The French Republic , The French Republic , The French Republic , (commonly known as France , is a unitary semi-presidential republic in Western Europe with several overseas territories and islands located on other continents and in the Indian, Pacific, and Atlantic oceans. Metropolitan France...
; the province of Provence
Provence
Provence ; Provençal: Provença in classical norm or Prouvènço in Mistralian norm) is a region of south eastern France on the Mediterranean adjacent to Italy. It is part of the administrative région of Provence-Alpes-Côte d'Azur...
in southeastern France; the regions of Tuscany
Tuscany
Tuscany is a region in Italy. It has an area of about 23,000 square kilometres and a population of about 3.75 million inhabitants. The regional capital is Florence ....
, Umbria
Umbria
Umbria is a region of modern central Italy. It is one of the smallest Italian regions and the only peninsular region that is landlocked.Its capital is Perugia.Assisi and Norcia are historical towns associated with St. Francis of Assisi, and St...
, and Latium
Latium
Lazio is one of the 20 administrative regions of Italy, situated in the central peninsular section of the country. With about 5.7 million residents and a GDP of more than 170 billion euros, Lazio is the third most populated and the second richest region of Italy...
in Italy
Italy
Italy , officially the Italian Republic languages]] under the European Charter for Regional or Minority Languages. In each of these, Italy's official name is as follows:;;;;;;;;), is a unitary parliamentary republic in South-Central Europe. To the north it borders France, Switzerland, Austria and...
; and Moldavia
Moldavia
Moldavia is a geographic and historical region and former principality in Eastern Europe, corresponding to the territory between the Eastern Carpathians and the Dniester river...
and the area around Russia's Ryazan Oblast
Ryazan Oblast
Ryazan Oblast is a federal subject of Russia . Its administrative center is the city of Ryazan, which is the oblast's largest city. Population: -Geography:...
and Republic of Mordovia
Mordovia
The Republic of Mordovia , also known as Mordvinia, is a federal subject of Russia . Its capital is the city of Saransk. Population: -Geography:The republic is located in the eastern part of the East European Plain of Russia...
in Eastern Europe. One subclade of Haplogroup I-M436, namely I-M284, has been found almost exclusively among the population of Great Britain
Great Britain
Great Britain or Britain is an island situated to the northwest of Continental Europe. It is the ninth largest island in the world, and the largest European island, as well as the largest of the British Isles...
, which has been taken to suggest that the clade may have a very long history in that island. It is notable, however, that the distributions of Haplogroup I-M253 and Haplogroup I-M436 seem to correlate fairly well with the extent of historical influence of Germanic peoples
Germanic peoples
The Germanic peoples are an Indo-European ethno-linguistic group of Northern European origin, identified by their use of the Indo-European Germanic languages which diversified out of Proto-Germanic during the Pre-Roman Iron Age.Originating about 1800 BCE from the Corded Ware Culture on the North...
, although the punctual presence of both haplogroups at a low frequency in the area of the historical regions of Bithynia
Bithynia
Bithynia was an ancient region, kingdom and Roman province in the northwest of Asia Minor, adjoining the Propontis, the Thracian Bosporus and the Euxine .-Description:...
and Galatia
Galatia
Ancient Galatia was an area in the highlands of central Anatolia in modern Turkey. Galatia was named for the immigrant Gauls from Thrace , who settled here and became its ruling caste in the 3rd century BC, following the Gallic invasion of the Balkans in 279 BC. It has been called the "Gallia" of...
in Turkey
Turkey
Turkey , known officially as the Republic of Turkey , is a Eurasian country located in Western Asia and in East Thrace in Southeastern Europe...
rather suggests a connection with the ancient Gauls
Gauls
The Gauls were a Celtic people living in Gaul, the region roughly corresponding to what is now France, Belgium, Switzerland and Northern Italy, from the Iron Age through the Roman period. They mostly spoke the Continental Celtic language called Gaulish....
of Thrace
Thrace
Thrace is a historical and geographic area in southeast Europe. As a geographical concept, Thrace designates a region bounded by the Balkan Mountains on the north, Rhodope Mountains and the Aegean Sea on the south, and by the Black Sea and the Sea of Marmara on the east...
, several tribes of which are recorded to have immigrated to those parts of Anatolia at the invitation of Nicomedes I of Bithynia
Nicomedes I of Bithynia
Nicomedes I , second king of Bithynia, was the eldest son of Zipoetes I, whom he succeeded on the throne in 278 BC.-Overview:He commenced his reign by putting to death two of his brothers but the third, subsequently called Zipoetes II, raised an insurrection against him and succeeded in maintaining...
. This suggestion is supported by recent genetic studies regarding Y-DNA Haplogroup I2b2-L38 have concluded that there was some Late Iron Age migration of Celtic La Tène people, through Belgium, to the British Isles including north-east Ireland.
Haplogroup I-M436 also occurs among approximately 1% of Sardinians.
Specifications of mutation
The technical details of U179 are:- Nucleotide change (rs2319818): G to A
- Position (base pair): 275
- Total size (base pairs): 220
- Forward 5′→ 3′: aaggggatatgacgactgatt
- Reverse 5′→ 3′: cagctcctcttttcaactctca
See also
- HaplogroupHaplogroupIn the study of molecular evolution, a haplogroup is a group of similar haplotypes that share a common ancestor having the same single nucleotide polymorphism mutation in both haplotypes. Because a haplogroup consists of similar haplotypes, this is what makes it possible to predict a haplogroup...
- Human Y-chromosome DNA haplogroupsHuman Y-chromosome DNA haplogroupsIn human genetics, a Human Y-chromosome DNA haplogroup is a haplogroup defined by differences in the non-recombining portions of DNA from the Y chromosome ....
- Haplogroup I1 (Y-DNA)Haplogroup I1 (Y-DNA)In human genetics, Haplogroup I1 is a Y chromosome haplogroup occurring at greatest frequency in Scandinavia, associated with the mutations identified as M253, M307, P30, and P40. These are known as single nucleotide polymorphisms . It is a subclade of Haplogroup I. Before a reclassification in...
- Haplogroup I2 (Y-DNA)Haplogroup I2 (Y-DNA)In human genetics, Haplogroup I2 is a Y-chromosome haplogroup. Until 2008, it was known as Haplogroup I1b. Haplogroup I2 might have originated in Southeastern Europe some 15,000 - 17,000 years ago and developed into three main subgroups : I2*, I2a, and I2b.-Subclades:Note: The systematic subclade...
Phylogenetic tree and distribution maps
- Y-DNA Haplogroup I and Its Subclades from the International Society of Genetic Genealogy (ISOGG)of 2008
- Phylogeography of Y-Chromosome Haplogroup I
- Frequency Distributions of Y-DNA Haplogroup I and its subclades - with Video Tutorial
- Frequency and Variance of I1b (now considered I2a2-M26)
- Map of 'I1a' (now considered I1-M253)
- Map of 'I1b' (now considered I2a-P37.2)
- Map of 'I1c' (now considered I2b-M223)
- Rescalled Haplogroup I Tree (K. Nordtvedt 2011).
Mailing Lists
- http://archiver.rootsweb.com/th/index/Y-DNA-HAPLOGROUP-I Y-DNA-HAPLOGROUP-I Archives
- Y-DNA-HAPLOGROUP-I Mailing List at Rootsweb.com
Projects
- I Project at FTDNA
- I1 Project at FTDNA
- I2* Project at FTDNA
- I2a project at FTDNA
- I2b project at FTDNA
- I2b2 L38+ project at FTDNA
- The Scandinavian yDNA Genealogical Project at FTDNA
- The Finland Genealogical Project at FTDNA
Other
- Study of Y-Haplogroup I and Modal Haplotypes
- The Y Chromosome Consortium (YCC)
- Example haplotypes from I1* "y cluster"
- YCC Haplogroup I page - I1a (now considered I1-M253), I1b (now considered I2a-P37.2) and I1c (now considered I2b-M223)
- Haplo-I Subclade Predictor
- Spread of Haplogroup I, from National Geographic
- I2b2 Y-DNA found in Bronze Age skeletons of Lichtenstein Cave
- Haplogroup I-L38 (I2b2) In Search of the Origin of I-L38 (aka I2b2)