Toxin-antitoxin system
Encyclopedia
A toxin-antitoxin system is a set of two or more closely linked gene
s that together encode both a protein 'poison' and a corresponding 'antidote'. When these systems are contained on plasmid
s – transferable genetic elements – they ensure that only the daughter cells that inherit
the plasmid survive after cell division
. If the plasmid is absent in a daughter cell, the unstable anti-toxin is degraded and the stable toxic protein kills the new cell; this is known as 'post-segregational killing' (PSK). Toxin-antitoxin systems are widely distributed in prokaryote
s, and organisms often have them in multiple copies.
Toxin-antitoxin systems are typically classified according to how the antitoxin neutralises the toxin. In a type I toxin-antitoxin system, the translation
of messenger RNA (mRNA) that encodes the toxin is inhibited by the binding of a small non-coding RNA
antitoxin to the mRNA. The protein toxin in a type II system is inhibited post-translationally by the binding of another protein
antitoxin. A single example of a type III toxin-antitoxin system has been described whereby a protein toxin is bound directly by an RNA molecule. Toxin-antitoxin gene
s are often transferred through horizontal gene transfer
and are associated with pathogenic bacteria, having been found on plasmids conferring antibiotic resistance
and virulence
.
Chromosomal
toxin-antitoxin systems also exist, some of which perform cell functions such as responding to stresses
, causing cell cycle
arrest and bringing about programmed cell death
. In evolution
ary terms, toxin-antitoxin systems can be considered selfish DNA
in that the purpose of the systems are to replicate, regardless of whether they benefit the host organism or not. Some have proposed adaptive theories to explain the evolution of toxin-antitoxin systems; for example, chromosomal toxin-antitoxin systems could have evolved to prevent the inheritance of large deletions of the host genome. Toxin-antitoxin systems have several biotechnological
applications, such as a method of maintaining plasmids in cell lines
, targets for antibiotic
s, and as positive selection vectors.
to increase the fitness
of plasmids in competition
with other plasmids. Thus, the toxin-antitoxin system confers an advantage to the host DNA by eliminating competing plasmids in cell progeny
. This theory was corroborated through computer modelling. This does not, however, explain the presence of toxin-antitoxin systems on chromosomes.
Chromosomal toxin-antitoxin systems have a number of adaptive theories explaining their success at natural selection
. The simplest explanation of their existence on chromosomes is that they prevent harmful large deletions of the cell's genome
, though arguably deletions of large coding regions are fatal to a daughter cell regardless. MazEF, a toxin-antitoxin locus found in E. coli and other bacteria, induces programmed cell death in response to starvation
, specifically a lack of amino acid
s. This releases the cell's contents for absorption by neighbouring cells, potentially preventing the death of close relatives, and thereby increasing the inclusive fitness
of the cell that perished. This is an example of altruism
and how bacterial colonies resemble multicellular organism
s.
Another theory states that chromosomal toxin-antitoxin systems are designed to be bacteriostatic
rather than bactericidal. RelE, for example, is a global inhibitor of translation during nutrient
stress, and its expression reduces the chance of starvation by lowering the cell's nutrient requirements. A homologue
of mazF toxin called mazF-mx is essential for fruiting body formation in Myxococcus xanthus
.
When nutrients become limiting in this swarming bacteria, a group of 50,000 cells converge into a fruiting body structure. The maxF-mx toxin is a component of this nutrient-stress pathway; it enables a percentage of cells within the fruiting body to form myxospores. It has been suggested that M. xanthus has hijacked the toxin-antitoxin system, replacing the antitoxin with its own molecular control to regulate its development
.
It has also been proposed that chromosomal copies of plasmid toxin-antitoxin systems may serve as anti-addiction module
s – a method of omitting a plasmid from progeny without suffering the effects of the toxin. An example of this is an antitoxin on the Erwinia chrysanthemi genome that counteracts the toxic activity of an F plasmid toxin counterpart.
Nine possible functions of toxin-antitoxin systems have been proposed. These are:
An experiment where five TA systems were deleted from a strain of E. coli found no evidence that the TA systems conferred an advantage to the host. This result casts doubt on the growth control and programmed cell death hypotheses.
Type I toxin-antitoxin systems rely on the base-pairing of complementary antitoxin RNA
with the toxin's mRNA. Translation of the mRNA is then inhibited either by degradation via RNase III
or by occluding the Shine-Dalgarno sequence
or ribosome binding site. Often the toxin and antitoxin are encoded on opposite strands of DNA. The 5' or 3' overlapping region between the two genes is the area involved in complementary
base-pairing, usually with between 19–23 contiguous base pairs.
Toxins of type I systems are small, hydrophobic proteins that confer toxicity by damaging cell membrane
s. Few intracellular targets of type I toxins have been identified, possibly due to the difficult nature of analysing proteins that are poisonous to their bacterial hosts.
Type I systems sometimes include a third component. In the case of the well-characterised hok/sok system
, in addition to the hok toxin and sok antitoxin, there is a third gene, called mok. This open reading frame
almost entirely overlaps that of the toxin, and the translation of the toxin is dependent on the translation of this third component. Thus the binding of antitoxin to toxin is sometimes a simplification, and the antitoxin in fact binds a third RNA, which then affects toxin translation
.
, which has been found through bioinformatics
searches to represent between 37 and 42% of all predicted type II loci.
Type II systems are organised in operon
s with the antitoxin protein typically being located upstream
of the toxin. The antitoxin inhibits the toxin by downregulating
its expression. The proteins are typically around 100 amino acid
s in length, and exhibit toxicity in a number of ways: CcdB protein, for example, affects DNA gyrase
by poisoning DNA topoisomerase
II whereas MazF protein is a toxic endoribonuclease that cleaves cellular mRNAs at specific sequence motif
s. The most common toxic activity is the protein acting as an endonuclease
, also known as an interferase.
A third protein can sometimes be involved in type II toxin-antitoxin systems. In the case of the aforementioned MazEF addiction module, in addition to the toxin and antitoxin there is a regulatory protein involved called MazG. MazG protein interacts with E. colis Era GTPase
and is described as a 'nucleoside triphosphate pyrophosphohydrolase,' which hydrolyses
nucleoside
triphosphates to monophosphates. Later research showed that MazG is transcribed in the same polycistronic mRNA as MazE and MazF, and that MazG bound the MazF toxin to further inhibit its activity.
. The toxic activity of ToxN is inhibited by ToxI RNA, an RNA with 5.5 direct repeats
of a 36 nucleotide motif (AGGTGATTTGCTACCTTTAAGTGCAGCTAGAAATTC). Crystallographic analysis
of ToxIN has found that ToxN inhibition requires the formation of a trimeric ToxIN complex, whereby three ToxI monomers bind three ToxN monomers; the complex is held together by extensive protein-RNA interactions.
of toxin-antitoxin systems have begun to be realised by several biotechnology organisations. A primary usage is in maintaining plasmids in a large bacterial cell culture
. In an experiment examining the effectiveness of the hok/sok locus, it was found that segregational stability of an inserted plasmid expressing beta-galactosidase
was increased by between 8 and 22 times compared to a control
culture lacking a toxin-antitoxin system. In large scale microorganism
processes such as fermentation
, progeny cells lacking the plasmid insert often have a higher fitness
than those who inherit the plasmid and can outcompete the desirable microorganisms. A toxin-antitoxin system maintains the plasmid thereby maintaining the efficiency of the industrial process.
Additionally, toxin-antitoxin systems may be a future target for antibiotic
s. Inducing suicide modules against pathogens could help combat the growing problem of multi-drug resistance. Antibiotics have been developed
that induce toxin MazF of the MazEF system to bring about death of E. coli. The antibiotic works by inhibiting the transcription of translation of the MazE antitoxin.
Toxin-antitoxin assays have been developed to characterise toxin potency
. Antitoxin is used in conjunction with a toxin to find the amount needed to neutralise a set amount of toxin. This technique was applied to the paralysis
toxin of the paralysis tick of Australia, Ixodes holocyclus.
Ensuring a plasmid accepts an insert is a common problem of DNA cloning
. Toxin-antitoxin systems can be used to positively select for only those cells that have taken up a plasmid containing the inserted gene of interest, screening out those that lack the inserted gene. An example of this application comes from CcdB-encoded toxin, which has been incorporated into plasmid vectors. The gene of interest is then targeted to recombine into the CcdB locus, inactivating the transcription of the toxic protein. Thus, cells containing the plasmid but not the insert perish due to the toxic effects of CcdB protein, and only those that incorporate the insert survive.
Another example application involves both the CcdB toxin and CcbA antitoxin. CcbB is found in recombinant bacterial genomes and an inactivated version of CcdA is inserted into a linearised plasmid vector. A short extra sequence is added to the gene of interest that activates the antitoxin when the insertion occurs. This method ensures orientation-specific
gene insertion.
Genetically modified organism
s must be contained in a pre-defined area during research. Toxin-antitoxin systems can cause cell suicide
in certain conditions, such as a lack of a lab-specific growth medium
they would not encounter outside of the controlled laboratory
set-up.
Gene
A gene is a molecular unit of heredity of a living organism. It is a name given to some stretches of DNA and RNA that code for a type of protein or for an RNA chain that has a function in the organism. Living beings depend on genes, as they specify all proteins and functional RNA chains...
s that together encode both a protein 'poison' and a corresponding 'antidote'. When these systems are contained on plasmid
Plasmid
In microbiology and genetics, a plasmid is a DNA molecule that is separate from, and can replicate independently of, the chromosomal DNA. They are double-stranded and, in many cases, circular...
s – transferable genetic elements – they ensure that only the daughter cells that inherit
Mendelian inheritance
Mendelian inheritance is a scientific description of how hereditary characteristics are passed from parent organisms to their offspring; it underlies much of genetics...
the plasmid survive after cell division
Cell division
Cell division is the process by which a parent cell divides into two or more daughter cells . Cell division is usually a small segment of a larger cell cycle. This type of cell division in eukaryotes is known as mitosis, and leaves the daughter cell capable of dividing again. The corresponding sort...
. If the plasmid is absent in a daughter cell, the unstable anti-toxin is degraded and the stable toxic protein kills the new cell; this is known as 'post-segregational killing' (PSK). Toxin-antitoxin systems are widely distributed in prokaryote
Prokaryote
The prokaryotes are a group of organisms that lack a cell nucleus , or any other membrane-bound organelles. The organisms that have a cell nucleus are called eukaryotes. Most prokaryotes are unicellular, but a few such as myxobacteria have multicellular stages in their life cycles...
s, and organisms often have them in multiple copies.
Toxin-antitoxin systems are typically classified according to how the antitoxin neutralises the toxin. In a type I toxin-antitoxin system, the translation
Translation (genetics)
In molecular biology and genetics, translation is the third stage of protein biosynthesis . In translation, messenger RNA produced by transcription is decoded by the ribosome to produce a specific amino acid chain, or polypeptide, that will later fold into an active protein...
of messenger RNA (mRNA) that encodes the toxin is inhibited by the binding of a small non-coding RNA
Non-coding RNA
A non-coding RNA is a functional RNA molecule that is not translated into a protein. Less-frequently used synonyms are non-protein-coding RNA , non-messenger RNA and functional RNA . The term small RNA is often used for short bacterial ncRNAs...
antitoxin to the mRNA. The protein toxin in a type II system is inhibited post-translationally by the binding of another protein
Protein-protein interaction
Protein–protein interactions occur when two or more proteins bind together, often to carry out their biological function. Many of the most important molecular processes in the cell such as DNA replication are carried out by large molecular machines that are built from a large number of protein...
antitoxin. A single example of a type III toxin-antitoxin system has been described whereby a protein toxin is bound directly by an RNA molecule. Toxin-antitoxin gene
Gene
A gene is a molecular unit of heredity of a living organism. It is a name given to some stretches of DNA and RNA that code for a type of protein or for an RNA chain that has a function in the organism. Living beings depend on genes, as they specify all proteins and functional RNA chains...
s are often transferred through horizontal gene transfer
Horizontal gene transfer
Horizontal gene transfer , also lateral gene transfer , is any process in which an organism incorporates genetic material from another organism without being the offspring of that organism...
and are associated with pathogenic bacteria, having been found on plasmids conferring antibiotic resistance
Antibiotic resistance
Antibiotic resistance is a type of drug resistance where a microorganism is able to survive exposure to an antibiotic. While a spontaneous or induced genetic mutation in bacteria may confer resistance to antimicrobial drugs, genes that confer resistance can be transferred between bacteria in a...
and virulence
Virulence
Virulence is by MeSH definition the degree of pathogenicity within a group or species of parasites as indicated by case fatality rates and/or the ability of the organism to invade the tissues of the host. The pathogenicity of an organism - its ability to cause disease - is determined by its...
.
Chromosomal
Chromosome
A chromosome is an organized structure of DNA and protein found in cells. It is a single piece of coiled DNA containing many genes, regulatory elements and other nucleotide sequences. Chromosomes also contain DNA-bound proteins, which serve to package the DNA and control its functions.Chromosomes...
toxin-antitoxin systems also exist, some of which perform cell functions such as responding to stresses
Stress (biology)
Stress is a term in psychology and biology, borrowed from physics and engineering and first used in the biological context in the 1930s, which has in more recent decades become commonly used in popular parlance...
, causing cell cycle
Cell cycle
The cell cycle, or cell-division cycle, is the series of events that takes place in a cell leading to its division and duplication . In cells without a nucleus , the cell cycle occurs via a process termed binary fission...
arrest and bringing about programmed cell death
Programmed cell death
Programmed cell-death is death of a cell in any form, mediated by an intracellular program. PCD is carried out in a regulated process which generally confers advantage during an organism's life-cycle...
. In evolution
Evolution
Evolution is any change across successive generations in the heritable characteristics of biological populations. Evolutionary processes give rise to diversity at every level of biological organisation, including species, individual organisms and molecules such as DNA and proteins.Life on Earth...
ary terms, toxin-antitoxin systems can be considered selfish DNA
Selfish DNA
Selfish DNA refers to those sequences of DNA which, in their purest form, have two distinct properties: the DNA sequence spreads by forming additional copies of itself within the genome; and it makes no specific contribution to the reproductive success of its host organism.This idea was sketched...
in that the purpose of the systems are to replicate, regardless of whether they benefit the host organism or not. Some have proposed adaptive theories to explain the evolution of toxin-antitoxin systems; for example, chromosomal toxin-antitoxin systems could have evolved to prevent the inheritance of large deletions of the host genome. Toxin-antitoxin systems have several biotechnological
Biotechnology
Biotechnology is a field of applied biology that involves the use of living organisms and bioprocesses in engineering, technology, medicine and other fields requiring bioproducts. Biotechnology also utilizes these products for manufacturing purpose...
applications, such as a method of maintaining plasmids in cell lines
Cell culture
Cell culture is the complex process by which cells are grown under controlled conditions. In practice, the term "cell culture" has come to refer to the culturing of cells derived from singlecellular eukaryotes, especially animal cells. However, there are also cultures of plants, fungi and microbes,...
, targets for antibiotic
Antibiotic
An antibacterial is a compound or substance that kills or slows down the growth of bacteria.The term is often used synonymously with the term antibiotic; today, however, with increased knowledge of the causative agents of various infectious diseases, antibiotic has come to denote a broader range of...
s, and as positive selection vectors.
Evolutionary advantage
Plasmid stabilising toxin-antitoxin systems have been used as examples of selfish DNA as part of the gene centered view of evolution. It has been theorised that toxin-antitoxin loci serve only to maintain their own DNA, at the expense of the host organism. Other theories propose the systems have evolvedEvolution
Evolution is any change across successive generations in the heritable characteristics of biological populations. Evolutionary processes give rise to diversity at every level of biological organisation, including species, individual organisms and molecules such as DNA and proteins.Life on Earth...
to increase the fitness
Fitness (biology)
Fitness is a central idea in evolutionary theory. It can be defined either with respect to a genotype or to a phenotype in a given environment...
of plasmids in competition
Competition (biology)
Competition is an interaction between organisms or species, in which the fitness of one is lowered by the presence of another. Limited supply of at least one resource used by both is required. Competition both within and between species is an important topic in ecology, especially community ecology...
with other plasmids. Thus, the toxin-antitoxin system confers an advantage to the host DNA by eliminating competing plasmids in cell progeny
Offspring
In biology, offspring is the product of reproduction, of a new organism produced by one or more parents.Collective offspring may be known as a brood or progeny in a more general way...
. This theory was corroborated through computer modelling. This does not, however, explain the presence of toxin-antitoxin systems on chromosomes.
Chromosomal toxin-antitoxin systems have a number of adaptive theories explaining their success at natural selection
Natural selection
Natural selection is the nonrandom process by which biologic traits become either more or less common in a population as a function of differential reproduction of their bearers. It is a key mechanism of evolution....
. The simplest explanation of their existence on chromosomes is that they prevent harmful large deletions of the cell's genome
Genome
In modern molecular biology and genetics, the genome is the entirety of an organism's hereditary information. It is encoded either in DNA or, for many types of virus, in RNA. The genome includes both the genes and the non-coding sequences of the DNA/RNA....
, though arguably deletions of large coding regions are fatal to a daughter cell regardless. MazEF, a toxin-antitoxin locus found in E. coli and other bacteria, induces programmed cell death in response to starvation
Starvation
Starvation is a severe deficiency in caloric energy, nutrient and vitamin intake. It is the most extreme form of malnutrition. In humans, prolonged starvation can cause permanent organ damage and eventually, death...
, specifically a lack of amino acid
Amino acid
Amino acids are molecules containing an amine group, a carboxylic acid group and a side-chain that varies between different amino acids. The key elements of an amino acid are carbon, hydrogen, oxygen, and nitrogen...
s. This releases the cell's contents for absorption by neighbouring cells, potentially preventing the death of close relatives, and thereby increasing the inclusive fitness
Inclusive fitness
In evolutionary biology and evolutionary psychology, the inclusive fitness of an organism is the sum of its classical fitness and the number of equivalents of its own offspring it can add to the population by supporting others...
of the cell that perished. This is an example of altruism
Altruism
Altruism is a concern for the welfare of others. It is a traditional virtue in many cultures, and a core aspect of various religious traditions, though the concept of 'others' toward whom concern should be directed can vary among cultures and religions. Altruism is the opposite of...
and how bacterial colonies resemble multicellular organism
Multicellular organism
Multicellular organisms are organisms that consist of more than one cell, in contrast to single-celled organisms. Most life that can be seen with the the naked eye is multicellular, as are all animals and land plants.-Evolutionary history:Multicellularity has evolved independently dozens of times...
s.
Another theory states that chromosomal toxin-antitoxin systems are designed to be bacteriostatic
Bacteriostatic agent
A bacteriostatic agent or bacteriostat, abbreviated Bstatic, is a biological or chemical agent that stops bacteria from reproducing, while not necessarily harming them otherwise. Depending on their application, bacteriostatic antibiotics, disinfectants, antiseptics and preservatives can be...
rather than bactericidal. RelE, for example, is a global inhibitor of translation during nutrient
Nutrient
A nutrient is a chemical that an organism needs to live and grow or a substance used in an organism's metabolism which must be taken in from its environment. They are used to build and repair tissues, regulate body processes and are converted to and used as energy...
stress, and its expression reduces the chance of starvation by lowering the cell's nutrient requirements. A homologue
Homology (biology)
Homology forms the basis of organization for comparative biology. In 1843, Richard Owen defined homology as "the same organ in different animals under every variety of form and function". Organs as different as a bat's wing, a seal's flipper, a cat's paw and a human hand have a common underlying...
of mazF toxin called mazF-mx is essential for fruiting body formation in Myxococcus xanthus
Myxococcus xanthus
Myxococcus xanthus colonies exist as a self-organized, predatory, saprotrophic, single-species biofilm called a swarm. Myxococcus xanthus, which can be found almost ubiquitously in soil, are thin rod shaped, gram-negative cells that exhibit self-organizing behavior as a response to environmental...
.
When nutrients become limiting in this swarming bacteria, a group of 50,000 cells converge into a fruiting body structure. The maxF-mx toxin is a component of this nutrient-stress pathway; it enables a percentage of cells within the fruiting body to form myxospores. It has been suggested that M. xanthus has hijacked the toxin-antitoxin system, replacing the antitoxin with its own molecular control to regulate its development
Developmental biology
Developmental biology is the study of the process by which organisms grow and develop. Modern developmental biology studies the genetic control of cell growth, differentiation and "morphogenesis", which is the process that gives rise to tissues, organs and anatomy.- Related fields of study...
.
It has also been proposed that chromosomal copies of plasmid toxin-antitoxin systems may serve as anti-addiction module
Addiction module
Addiction modules are toxin-antitoxin systems. Each consists of a pair of genes that specify two components: a stable toxin and an unstable antitoxin that interferes with the lethal action of the toxin. Found first in E. coli on low copy number plasmids, addiction modules are responsible for a...
s – a method of omitting a plasmid from progeny without suffering the effects of the toxin. An example of this is an antitoxin on the Erwinia chrysanthemi genome that counteracts the toxic activity of an F plasmid toxin counterpart.
Nine possible functions of toxin-antitoxin systems have been proposed. These are:
- Junk – they have been acquired from plasmids and retained due to their addictive nature.
- Stabilisation of genomic parasites – chromosomal remnants from transposonTransposonTransposable elements are sequences of DNA that can move or transpose themselves to new positions within the genome of a single cell. The mechanism of transposition can be either "copy and paste" or "cut and paste". Transposition can create phenotypically significant mutations and alter the cell's...
s and bacteriophageBacteriophageA bacteriophage is any one of a number of viruses that infect bacteria. They do this by injecting genetic material, which they carry enclosed in an outer protein capsid...
s. - Selfish alleles – non-addictive alleles are unable to replace addictive alleles during recombinationGenetic recombinationGenetic recombination is a process by which a molecule of nucleic acid is broken and then joined to a different one. Recombination can occur between similar molecules of DNA, as in homologous recombination, or dissimilar molecules, as in non-homologous end joining. Recombination is a common method...
but the opposite is able to occur. - Gene regulation – some toxins act as a means of general repression of gene expression while others are more specific.
- Growth control – bacteriostatic toxins, as mentioned above, restrict growth rather than killing the host cell.
- Persisters – some bacterial populations contain a sub-population of 'persisters'Multidrug toleranceMultidrug tolerance or antibiotic tolerance is the ability of a disease-causing microorganism to resist killing by antibiotics or other antimicrobials. It is mechanistically distinct from multidrug resistance: It is not caused by mutant microbes, but rather by microbial cells that exist in a...
controlled by toxin-antitoxin systems that are slow-growing, hardy individuals, which potentially insure the population against catastrophic loss. - Programmed cell arrest and the preservation of the commons – the altruistic explanation as demonstrated by MazEF, detailed above.
- Programmed cell death – similar to the above function, although individuals must have variable stress survival level to prevent entire population destruction.
- Antiphage mechanism – when bacteriophageBacteriophageA bacteriophage is any one of a number of viruses that infect bacteria. They do this by injecting genetic material, which they carry enclosed in an outer protein capsid...
interrupt the host cell's transcription and translation, a toxin-antitoxin system may be activated that limits the phage's replication.
An experiment where five TA systems were deleted from a strain of E. coli found no evidence that the TA systems conferred an advantage to the host. This result casts doubt on the growth control and programmed cell death hypotheses.
Type I
RNA
Ribonucleic acid , or RNA, is one of the three major macromolecules that are essential for all known forms of life....
with the toxin's mRNA. Translation of the mRNA is then inhibited either by degradation via RNase III
RNase III
RNase III enzymes specifically bind to and cleave double-stranded RNA . There are three subdivisions, known as Class 1, 2, and 3.Prokaryotic ribonuclease III is an enzyme that digests double-stranded RNA. It is involved in the processing of ribosomal RNA precursors and of some mRNAs.* Class 1...
or by occluding the Shine-Dalgarno sequence
Shine-Dalgarno sequence
The Shine-Dalgarno sequence , proposed by Australian scientists John Shine and Lynn Dalgarno , is a ribosomal binding site in the mRNA, generally located 8 basepairs upstream of the start codon AUG. The Shine-Dalgarno sequence exists only in prokaryotes. The six-base consensus sequence is AGGAGG;...
or ribosome binding site. Often the toxin and antitoxin are encoded on opposite strands of DNA. The 5' or 3' overlapping region between the two genes is the area involved in complementary
Complementary DNA
In genetics, complementary DNA is DNA synthesized from a messenger RNA template in a reaction catalyzed by the enzyme reverse transcriptase and the enzyme DNA polymerase. cDNA is often used to clone eukaryotic genes in prokaryotes...
base-pairing, usually with between 19–23 contiguous base pairs.
Toxins of type I systems are small, hydrophobic proteins that confer toxicity by damaging cell membrane
Cell membrane
The cell membrane or plasma membrane is a biological membrane that separates the interior of all cells from the outside environment. The cell membrane is selectively permeable to ions and organic molecules and controls the movement of substances in and out of cells. It basically protects the cell...
s. Few intracellular targets of type I toxins have been identified, possibly due to the difficult nature of analysing proteins that are poisonous to their bacterial hosts.
Type I systems sometimes include a third component. In the case of the well-characterised hok/sok system
Hok/sok system
The hok/sok system is a postsegregational killing mechanism employed by the R1 plasmid in Escherichia coli. It was the first type I toxin-antitoxin pair to be identified through characterisation of a plasmid-stabilising locus...
, in addition to the hok toxin and sok antitoxin, there is a third gene, called mok. This open reading frame
Open reading frame
In molecular genetics, an open reading frame is a DNA sequence that does not contain a stop codon in a given reading frame.Normally, inserts which interrupt the reading frame of a subsequent region after the start codon cause frameshift mutation of the sequence and dislocate the sequences for stop...
almost entirely overlaps that of the toxin, and the translation of the toxin is dependent on the translation of this third component. Thus the binding of antitoxin to toxin is sometimes a simplification, and the antitoxin in fact binds a third RNA, which then affects toxin translation
Translation (genetics)
In molecular biology and genetics, translation is the third stage of protein biosynthesis . In translation, messenger RNA produced by transcription is decoded by the ribosome to produce a specific amino acid chain, or polypeptide, that will later fold into an active protein...
.
Example systems
| Toxin | Antitoxin | Notes | Ref. |
|---|---|---|---|
| Hok Hok/sok system The hok/sok system is a postsegregational killing mechanism employed by the R1 plasmid in Escherichia coli. It was the first type I toxin-antitoxin pair to be identified through characterisation of a plasmid-stabilising locus... |
Sok Hok/sok system The hok/sok system is a postsegregational killing mechanism employed by the R1 plasmid in Escherichia coli. It was the first type I toxin-antitoxin pair to be identified through characterisation of a plasmid-stabilising locus... |
The original and best-understood type I toxin-antitoxin system (pictured), which stabilises plasmids in a number of gram-negative bacteria | |
| fst Par stability determinant The par stability determinant is a 400bp locus of the pAD1 plasmid which encodes a type I toxin-antitoxin system in Enterococcus faecalis... |
RNAII Par stability determinant The par stability determinant is a 400bp locus of the pAD1 plasmid which encodes a type I toxin-antitoxin system in Enterococcus faecalis... |
The first type I system to be identified in gram-positive bacteria | |
| TisB | IstR | Responds to DNA damage | |
| LdrD RdlD RNA RdlD RNA is a family of small non-coding RNAs which repress the protein LdrD in a type I toxin-antitoxin system. It was discovered in Escherichia coli strain K-12 in a long direct repeat named LDR-D. This locus encodes two products: a 35 amino acid peptide toxin and a 60 nucleotide RNA antitoxin... |
RdlD RdlD RNA RdlD RNA is a family of small non-coding RNAs which repress the protein LdrD in a type I toxin-antitoxin system. It was discovered in Escherichia coli strain K-12 in a long direct repeat named LDR-D. This locus encodes two products: a 35 amino acid peptide toxin and a 60 nucleotide RNA antitoxin... |
A chromosomal system in Enterobacteriaceae Enterobacteriaceae The Enterobacteriaceae is a large family of bacteria that includes many of the more familiar pathogens, such as Salmonella, Escherichia coli, Yersinia pestis, Klebsiella and Shigella. This family is the only representative in the order Enterobacteriales of the class Gammaproteobacteria in the... |
|
| FlmA | FlmB FlmB RNA FlmB RNA is a family of non-coding RNAs which form a type-1 toxin antitoxin system with the protein toxin FlmA... |
A hok/sok homologue, which also stabilises the F plasmid | |
| Ibs | Sib | Discovered in E. coli intergenic regions, the antitoxin was originally named QUAD RNA | |
| TxpA | RatA RatA RatA is a non-coding 222nt sRNA first identified in Bacillus subtilis. It is part of a type-I toxin-antitoxin system along with the protein toxin named TxpA .... |
Ensures the inheritance of the skin element during sporulation in Bacillus subtilis Bacillus subtilis Bacillus subtilis, known also as the hay bacillus or grass bacillus, is a Gram-positive, catalase-positive bacterium commonly found in soil. A member of the genus Bacillus, B. subtilis is rod-shaped, and has the ability to form a tough, protective endospore, allowing the organism to tolerate... |
|
| SymE | SymR SymR RNA SymR RNA is a non-coding RNA which forms a type I toxin-antitoxin system along with the protein SymE. SymR was originally labelled RyjC and is a 77nt RNA with a σ70 promoter. RyjC was found to overlap the yjiW open reading frame on the opposite strand by 6nt, and was characterised as an antisense... |
A chromosomal system induced as an SOS response SOS response The SOS response is a global response to DNA damage in which the cell cycle is arrested and DNA repair and mutagenesis are induced. The SOS uses the RecA protein . The RecA protein, stimulated by single-stranded DNA, is involved in the inactivation of the LexA repressor thereby inducing the response... |
|
| XCV2162 | ptaRNA1 | A system identified in Xanthomonas campestris Xanthomonas campestris Xanthomonas campestris is a bacterial species that causes a variety of plant diseases. Available from the NCPPB,and other international Culture collections such as ICMP, ATCC, and LMG in a purified form, it is used in the commercial production of a high-molecular-weight polysaccharide - xanthan... with erratic phylogenetic distribution. |
Type II
Type II toxin-antitoxin systems are generally better-understood than type I. In this system a labile protein antitoxin tightly binds and inhibits the activity of a stable toxin. The largest family of type II toxin-antitoxin systems is vapBCVapBC
VapBC is the largest family of type II toxin-antitoxin system genetic loci in prokaryotes. VapBC operons consist of two genes: VapC encodes a toxic PilT N-terminus domain, and VapB encodes a matching antitoxin...
, which has been found through bioinformatics
Bioinformatics
Bioinformatics is the application of computer science and information technology to the field of biology and medicine. Bioinformatics deals with algorithms, databases and information systems, web technologies, artificial intelligence and soft computing, information and computation theory, software...
searches to represent between 37 and 42% of all predicted type II loci.
Type II systems are organised in operon
Operon
In genetics, an operon is a functioning unit of genomic DNA containing a cluster of genes under the control of a single regulatory signal or promoter. The genes are transcribed together into an mRNA strand and either translated together in the cytoplasm, or undergo trans-splicing to create...
s with the antitoxin protein typically being located upstream
Upstream and downstream (DNA)
In molecular biology and genetics, upstream and downstream both refer to a relative position in DNA or RNA. Each strand of DNA or RNA has a 5' end and a 3' end, so named for the carbons on the deoxyribose ring. Relative to the position on the strand, downstream is the region towards the 3' end of...
of the toxin. The antitoxin inhibits the toxin by downregulating
Downregulation and upregulation
Downregulation is the process by which a cell decreases the quantity of a cellular component, such as RNA or protein, in response to an external variable...
its expression. The proteins are typically around 100 amino acid
Amino acid
Amino acids are molecules containing an amine group, a carboxylic acid group and a side-chain that varies between different amino acids. The key elements of an amino acid are carbon, hydrogen, oxygen, and nitrogen...
s in length, and exhibit toxicity in a number of ways: CcdB protein, for example, affects DNA gyrase
DNA gyrase
DNA gyrase, often referred to simply as gyrase, is an enzyme that relieves strain while double-stranded DNA is being unwound by helicase. This causes negative supercoiling of the DNA...
by poisoning DNA topoisomerase
Topoisomerase
Topoisomerases are enzymes that regulate the overwinding or underwinding of DNA. The winding problem of DNA arises due to the intertwined nature of its double helical structure. For example, during DNA replication, DNA becomes overwound ahead of a replication fork...
II whereas MazF protein is a toxic endoribonuclease that cleaves cellular mRNAs at specific sequence motif
Sequence motif
In genetics, a sequence motif is a nucleotide or amino-acid sequence pattern that is widespread and has, or is conjectured to have, a biological significance...
s. The most common toxic activity is the protein acting as an endonuclease
Endonuclease
Endonucleases are enzymes that cleave the phosphodiester bond within a polynucleotide chain, in contrast to exonucleases, which cleave phosphodiester bonds at the end of a polynucleotide chain. Typically, a restriction site will be a palindromic sequence four to six nucleotides long. Most...
, also known as an interferase.
A third protein can sometimes be involved in type II toxin-antitoxin systems. In the case of the aforementioned MazEF addiction module, in addition to the toxin and antitoxin there is a regulatory protein involved called MazG. MazG protein interacts with E. colis Era GTPase
GTPase
GTPases are a large family of hydrolase enzymes that can bind and hydrolyze guanosine triphosphate . The GTP binding and hydrolysis takes place in the highly conserved G domain common to all GTPases.-Functions:...
and is described as a 'nucleoside triphosphate pyrophosphohydrolase,' which hydrolyses
Hydrolysis
Hydrolysis is a chemical reaction during which molecules of water are split into hydrogen cations and hydroxide anions in the process of a chemical mechanism. It is the type of reaction that is used to break down certain polymers, especially those made by condensation polymerization...
nucleoside
Nucleoside
Nucleosides are glycosylamines consisting of a nucleobase bound to a ribose or deoxyribose sugar via a beta-glycosidic linkage...
triphosphates to monophosphates. Later research showed that MazG is transcribed in the same polycistronic mRNA as MazE and MazF, and that MazG bound the MazF toxin to further inhibit its activity.
Example systems
| Toxin | Antitoxin | Notes | Ref. |
|---|---|---|---|
| CcdB | CcdA | Found on the F plasmid of Escherichia coli Escherichia coli Escherichia coli is a Gram-negative, rod-shaped bacterium that is commonly found in the lower intestine of warm-blooded organisms . Most E. coli strains are harmless, but some serotypes can cause serious food poisoning in humans, and are occasionally responsible for product recalls... |
|
| ParE | ParD | Found in multiple copies in Caulobacter crescentus Caulobacter crescentus Caulobacter crescentus is a Gram-negative, oligotrophic bacterium widely distributed in fresh water lakes and streams.Caulobacter is an important model organism for studying the regulation of the cell cycle, asymmetric cell division, and cellular differentiation. Caulobacter daughter cells have... |
|
| MazF | MazE | Found in E. coli and in chromosome Chromosome A chromosome is an organized structure of DNA and protein found in cells. It is a single piece of coiled DNA containing many genes, regulatory elements and other nucleotide sequences. Chromosomes also contain DNA-bound proteins, which serve to package the DNA and control its functions.Chromosomes... s of other bacteria |
|
| yafO | yafN | A system induced by the SOS response to DNA damage in E. coli | |
| HicB | HicA | Found in archaea Archaea The Archaea are a group of single-celled microorganisms. A single individual or species from this domain is called an archaeon... and bacteria, it is not clear which component is toxin and which is antitoxin |
|
| Kid | Kis | Stabilises the R1 plasmid R1 plasmid The R1 Plasmid is a plasmid that was first isolated from Salmonella paratyphi bacteria in 1963.The R1 plasmid imparts multi-drug antibiotic resistance to its host bacteria.... and is related to the CcdB/A system |
Type III
Type III toxin-antitoxin systems rely on direct interaction between a toxic protein and an RNA antitoxin. The toxic effects of the protein are neutralised by the RNA gene. Only one example has been discovered: the ToxIN system from the bacterial plant pathogen Erwinia carotovora. The toxic ToxN protein is approximately 170 amino acids long and has been shown to be toxic to E. coliEscherichia coli
Escherichia coli is a Gram-negative, rod-shaped bacterium that is commonly found in the lower intestine of warm-blooded organisms . Most E. coli strains are harmless, but some serotypes can cause serious food poisoning in humans, and are occasionally responsible for product recalls...
. The toxic activity of ToxN is inhibited by ToxI RNA, an RNA with 5.5 direct repeats
Tandem repeat
Tandem repeats occur in DNA when a pattern of two or more nucleotides is repeated and the repetitions are directly adjacent to each other. -Example:An example would be:in which the sequence A-T-T-C-G is repeated three times.-Terminology:...
of a 36 nucleotide motif (AGGTGATTTGCTACCTTTAAGTGCAGCTAGAAATTC). Crystallographic analysis
Crystallography
Crystallography is the experimental science of the arrangement of atoms in solids. The word "crystallography" derives from the Greek words crystallon = cold drop / frozen drop, with its meaning extending to all solids with some degree of transparency, and grapho = write.Before the development of...
of ToxIN has found that ToxN inhibition requires the formation of a trimeric ToxIN complex, whereby three ToxI monomers bind three ToxN monomers; the complex is held together by extensive protein-RNA interactions.
Biotechnological applications
The biotechnological applicationsBiotechnology
Biotechnology is a field of applied biology that involves the use of living organisms and bioprocesses in engineering, technology, medicine and other fields requiring bioproducts. Biotechnology also utilizes these products for manufacturing purpose...
of toxin-antitoxin systems have begun to be realised by several biotechnology organisations. A primary usage is in maintaining plasmids in a large bacterial cell culture
Cell culture
Cell culture is the complex process by which cells are grown under controlled conditions. In practice, the term "cell culture" has come to refer to the culturing of cells derived from singlecellular eukaryotes, especially animal cells. However, there are also cultures of plants, fungi and microbes,...
. In an experiment examining the effectiveness of the hok/sok locus, it was found that segregational stability of an inserted plasmid expressing beta-galactosidase
Beta-galactosidase
β-galactosidase, also called beta-gal or β-gal, is a hydrolase enzyme that catalyzes the hydrolysis of β-galactosides into monosaccharides. Substrates of different β-galactosidases include ganglioside GM1, lactosylceramides, lactose, and various glycoproteins...
was increased by between 8 and 22 times compared to a control
Scientific control
Scientific control allows for comparisons of concepts. It is a part of the scientific method. Scientific control is often used in discussion of natural experiments. For instance, during drug testing, scientists will try to control two groups to keep them as identical and normal as possible, then...
culture lacking a toxin-antitoxin system. In large scale microorganism
Microorganism
A microorganism or microbe is a microscopic organism that comprises either a single cell , cell clusters, or no cell at all...
processes such as fermentation
Industrial fermentation
Industrial fermentation is the intentional use of fermentation by microorganisms such as bacteria and fungi to make products useful to humans. Fermented products have applications as food as well as in general industry.- Food fermentation :...
, progeny cells lacking the plasmid insert often have a higher fitness
Fitness (biology)
Fitness is a central idea in evolutionary theory. It can be defined either with respect to a genotype or to a phenotype in a given environment...
than those who inherit the plasmid and can outcompete the desirable microorganisms. A toxin-antitoxin system maintains the plasmid thereby maintaining the efficiency of the industrial process.
Additionally, toxin-antitoxin systems may be a future target for antibiotic
Antibiotic
An antibacterial is a compound or substance that kills or slows down the growth of bacteria.The term is often used synonymously with the term antibiotic; today, however, with increased knowledge of the causative agents of various infectious diseases, antibiotic has come to denote a broader range of...
s. Inducing suicide modules against pathogens could help combat the growing problem of multi-drug resistance. Antibiotics have been developed
Drug development
Drug development is a blanket term used to define the process of bringing a new drug to the market once a lead compound has been identified through the process of drug discovery...
that induce toxin MazF of the MazEF system to bring about death of E. coli. The antibiotic works by inhibiting the transcription of translation of the MazE antitoxin.
Toxin-antitoxin assays have been developed to characterise toxin potency
Potency (pharmacology)
In the field of pharmacology, potency is a measure of drug activity expressed in terms of the amount required to produce an effect of given intensity. A highly potent drug evokes a larger response at low concentrations, while a drug of lower potency evokes a small response at low concentrations...
. Antitoxin is used in conjunction with a toxin to find the amount needed to neutralise a set amount of toxin. This technique was applied to the paralysis
Paralysis
Paralysis is loss of muscle function for one or more muscles. Paralysis can be accompanied by a loss of feeling in the affected area if there is sensory damage as well as motor. A study conducted by the Christopher & Dana Reeve Foundation, suggests that about 1 in 50 people have been diagnosed...
toxin of the paralysis tick of Australia, Ixodes holocyclus.
Ensuring a plasmid accepts an insert is a common problem of DNA cloning
Cloning
Cloning in biology is the process of producing similar populations of genetically identical individuals that occurs in nature when organisms such as bacteria, insects or plants reproduce asexually. Cloning in biotechnology refers to processes used to create copies of DNA fragments , cells , or...
. Toxin-antitoxin systems can be used to positively select for only those cells that have taken up a plasmid containing the inserted gene of interest, screening out those that lack the inserted gene. An example of this application comes from CcdB-encoded toxin, which has been incorporated into plasmid vectors. The gene of interest is then targeted to recombine into the CcdB locus, inactivating the transcription of the toxic protein. Thus, cells containing the plasmid but not the insert perish due to the toxic effects of CcdB protein, and only those that incorporate the insert survive.
Another example application involves both the CcdB toxin and CcbA antitoxin. CcbB is found in recombinant bacterial genomes and an inactivated version of CcdA is inserted into a linearised plasmid vector. A short extra sequence is added to the gene of interest that activates the antitoxin when the insertion occurs. This method ensures orientation-specific
Directionality (molecular biology)
Directionality, in molecular biology and biochemistry, is the end-to-end chemical orientation of a single strand of nucleic acid. The chemical convention of naming carbon atoms in the nucleotide sugar-ring numerically gives rise to a 5′-end and a 3′-end...
gene insertion.
Genetically modified organism
Genetically modified organism
A genetically modified organism or genetically engineered organism is an organism whose genetic material has been altered using genetic engineering techniques. These techniques, generally known as recombinant DNA technology, use DNA molecules from different sources, which are combined into one...
s must be contained in a pre-defined area during research. Toxin-antitoxin systems can cause cell suicide
Suicide
Suicide is the act of intentionally causing one's own death. Suicide is often committed out of despair or attributed to some underlying mental disorder, such as depression, bipolar disorder, schizophrenia, alcoholism, or drug abuse...
in certain conditions, such as a lack of a lab-specific growth medium
Growth medium
A growth medium or culture medium is a liquid or gel designed to support the growth of microorganisms or cells, or small plants like the moss Physcomitrella patens.There are different types of media for growing different types of cells....
they would not encounter outside of the controlled laboratory
Laboratory
A laboratory is a facility that provides controlled conditions in which scientific research, experiments, and measurement may be performed. The title of laboratory is also used for certain other facilities where the processes or equipment used are similar to those in scientific laboratories...
set-up.
External links
- RASTA - Rapid Automated Scan for Toxins and Antitoxins in Bacteria